ID: 983266032

View in Genome Browser
Species Human (GRCh38)
Location 4:165509153-165509175
Sequence TCGCTAGCAACCACATCGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983266029_983266032 0 Left 983266029 4:165509130-165509152 CCCAGGACTTGTTAGCACCTTAT No data
Right 983266032 4:165509153-165509175 TCGCTAGCAACCACATCGACTGG No data
983266028_983266032 13 Left 983266028 4:165509117-165509139 CCATGCAGCTATACCCAGGACTT No data
Right 983266032 4:165509153-165509175 TCGCTAGCAACCACATCGACTGG No data
983266030_983266032 -1 Left 983266030 4:165509131-165509153 CCAGGACTTGTTAGCACCTTATT No data
Right 983266032 4:165509153-165509175 TCGCTAGCAACCACATCGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983266032 Original CRISPR TCGCTAGCAACCACATCGAC TGG Intergenic
No off target data available for this crispr