ID: 983266039

View in Genome Browser
Species Human (GRCh38)
Location 4:165509163-165509185
Sequence CCCCCAGCCCCCAGTCGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983266039_983266042 -5 Left 983266039 4:165509163-165509185 CCACATCGACTGGGGGCTGGGGG No data
Right 983266042 4:165509181-165509203 GGGGGATACCAGAACTCTGAGGG No data
983266039_983266044 2 Left 983266039 4:165509163-165509185 CCACATCGACTGGGGGCTGGGGG No data
Right 983266044 4:165509188-165509210 ACCAGAACTCTGAGGGGACCTGG No data
983266039_983266049 30 Left 983266039 4:165509163-165509185 CCACATCGACTGGGGGCTGGGGG No data
Right 983266049 4:165509216-165509238 GAGGTGTGAGAGAAGAGGATAGG No data
983266039_983266041 -6 Left 983266039 4:165509163-165509185 CCACATCGACTGGGGGCTGGGGG No data
Right 983266041 4:165509180-165509202 TGGGGGATACCAGAACTCTGAGG No data
983266039_983266046 11 Left 983266039 4:165509163-165509185 CCACATCGACTGGGGGCTGGGGG No data
Right 983266046 4:165509197-165509219 CTGAGGGGACCTGGAATCAGAGG No data
983266039_983266043 -4 Left 983266039 4:165509163-165509185 CCACATCGACTGGGGGCTGGGGG No data
Right 983266043 4:165509182-165509204 GGGGATACCAGAACTCTGAGGGG No data
983266039_983266048 25 Left 983266039 4:165509163-165509185 CCACATCGACTGGGGGCTGGGGG No data
Right 983266048 4:165509211-165509233 AATCAGAGGTGTGAGAGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983266039 Original CRISPR CCCCCAGCCCCCAGTCGATG TGG (reversed) Intergenic
No off target data available for this crispr