ID: 983266040

View in Genome Browser
Species Human (GRCh38)
Location 4:165509163-165509185
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983266031_983266040 -7 Left 983266031 4:165509147-165509169 CCTTATTCGCTAGCAACCACATC No data
Right 983266040 4:165509163-165509185 CCACATCGACTGGGGGCTGGGGG No data
983266028_983266040 23 Left 983266028 4:165509117-165509139 CCATGCAGCTATACCCAGGACTT No data
Right 983266040 4:165509163-165509185 CCACATCGACTGGGGGCTGGGGG No data
983266030_983266040 9 Left 983266030 4:165509131-165509153 CCAGGACTTGTTAGCACCTTATT No data
Right 983266040 4:165509163-165509185 CCACATCGACTGGGGGCTGGGGG No data
983266029_983266040 10 Left 983266029 4:165509130-165509152 CCCAGGACTTGTTAGCACCTTAT No data
Right 983266040 4:165509163-165509185 CCACATCGACTGGGGGCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr