ID: 983266044

View in Genome Browser
Species Human (GRCh38)
Location 4:165509188-165509210
Sequence ACCAGAACTCTGAGGGGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983266039_983266044 2 Left 983266039 4:165509163-165509185 CCACATCGACTGGGGGCTGGGGG No data
Right 983266044 4:165509188-165509210 ACCAGAACTCTGAGGGGACCTGG No data
983266031_983266044 18 Left 983266031 4:165509147-165509169 CCTTATTCGCTAGCAACCACATC No data
Right 983266044 4:165509188-165509210 ACCAGAACTCTGAGGGGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983266044 Original CRISPR ACCAGAACTCTGAGGGGACC TGG Intergenic
No off target data available for this crispr