ID: 983271372

View in Genome Browser
Species Human (GRCh38)
Location 4:165566045-165566067
Sequence CTACTACTCCACCACAGGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983271372_983271375 28 Left 983271372 4:165566045-165566067 CCATACCTGTGGTGGAGTAGTAG No data
Right 983271375 4:165566096-165566118 AAAGTATTATTGACGCTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983271372 Original CRISPR CTACTACTCCACCACAGGTA TGG (reversed) Intergenic
No off target data available for this crispr