ID: 983273166

View in Genome Browser
Species Human (GRCh38)
Location 4:165587219-165587241
Sequence TAATTTTACTAGTGGGCTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983273166_983273169 0 Left 983273166 4:165587219-165587241 CCAAAAGCCCACTAGTAAAATTA No data
Right 983273169 4:165587242-165587264 TTACACATTAAACTCTTTAATGG No data
983273166_983273170 7 Left 983273166 4:165587219-165587241 CCAAAAGCCCACTAGTAAAATTA No data
Right 983273170 4:165587249-165587271 TTAAACTCTTTAATGGTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983273166 Original CRISPR TAATTTTACTAGTGGGCTTT TGG (reversed) Intergenic
No off target data available for this crispr