ID: 983274962

View in Genome Browser
Species Human (GRCh38)
Location 4:165605689-165605711
Sequence ACTTCCAAGCTCACTCATTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983274955_983274962 24 Left 983274955 4:165605642-165605664 CCACGTTAAAACTCACTCACATG No data
Right 983274962 4:165605689-165605711 ACTTCCAAGCTCACTCATTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983274962 Original CRISPR ACTTCCAAGCTCACTCATTA GGG Intergenic
No off target data available for this crispr