ID: 983274977

View in Genome Browser
Species Human (GRCh38)
Location 4:165605782-165605804
Sequence CAGAATACAGAGAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983274972_983274977 6 Left 983274972 4:165605753-165605775 CCAAGACCAAGATTGTCATGAAA No data
Right 983274977 4:165605782-165605804 CAGAATACAGAGAAGGAGGAAGG No data
983274974_983274977 0 Left 983274974 4:165605759-165605781 CCAAGATTGTCATGAAAAGGAGA No data
Right 983274977 4:165605782-165605804 CAGAATACAGAGAAGGAGGAAGG No data
983274970_983274977 8 Left 983274970 4:165605751-165605773 CCCCAAGACCAAGATTGTCATGA No data
Right 983274977 4:165605782-165605804 CAGAATACAGAGAAGGAGGAAGG No data
983274971_983274977 7 Left 983274971 4:165605752-165605774 CCCAAGACCAAGATTGTCATGAA No data
Right 983274977 4:165605782-165605804 CAGAATACAGAGAAGGAGGAAGG No data
983274968_983274977 29 Left 983274968 4:165605730-165605752 CCTCTCCAGGACAGCTTGCTTCC No data
Right 983274977 4:165605782-165605804 CAGAATACAGAGAAGGAGGAAGG No data
983274969_983274977 24 Left 983274969 4:165605735-165605757 CCAGGACAGCTTGCTTCCCCAAG No data
Right 983274977 4:165605782-165605804 CAGAATACAGAGAAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983274977 Original CRISPR CAGAATACAGAGAAGGAGGA AGG Intergenic
No off target data available for this crispr