ID: 983276007

View in Genome Browser
Species Human (GRCh38)
Location 4:165618513-165618535
Sequence CAATTGTTCTTAAGGACATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983276007_983276011 -9 Left 983276007 4:165618513-165618535 CCAGATGTCCTTAAGAACAATTG No data
Right 983276011 4:165618527-165618549 GAACAATTGATATTCATGGGAGG No data
983276007_983276013 26 Left 983276007 4:165618513-165618535 CCAGATGTCCTTAAGAACAATTG No data
Right 983276013 4:165618562-165618584 GAACATTCCTGTTAGAATTTGGG No data
983276007_983276012 25 Left 983276007 4:165618513-165618535 CCAGATGTCCTTAAGAACAATTG No data
Right 983276012 4:165618561-165618583 TGAACATTCCTGTTAGAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983276007 Original CRISPR CAATTGTTCTTAAGGACATC TGG (reversed) Intergenic
No off target data available for this crispr