ID: 983276952

View in Genome Browser
Species Human (GRCh38)
Location 4:165629342-165629364
Sequence CCATAGGAAATAAATGCAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983276952_983276957 5 Left 983276952 4:165629342-165629364 CCCATTGCATTTATTTCCTATGG No data
Right 983276957 4:165629370-165629392 ATAAGAAATTGCAATAACCATGG No data
983276952_983276958 19 Left 983276952 4:165629342-165629364 CCCATTGCATTTATTTCCTATGG No data
Right 983276958 4:165629384-165629406 TAACCATGGCTTAAAACAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983276952 Original CRISPR CCATAGGAAATAAATGCAAT GGG (reversed) Intergenic
No off target data available for this crispr