ID: 983276957

View in Genome Browser
Species Human (GRCh38)
Location 4:165629370-165629392
Sequence ATAAGAAATTGCAATAACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983276952_983276957 5 Left 983276952 4:165629342-165629364 CCCATTGCATTTATTTCCTATGG No data
Right 983276957 4:165629370-165629392 ATAAGAAATTGCAATAACCATGG No data
983276954_983276957 4 Left 983276954 4:165629343-165629365 CCATTGCATTTATTTCCTATGGC No data
Right 983276957 4:165629370-165629392 ATAAGAAATTGCAATAACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983276957 Original CRISPR ATAAGAAATTGCAATAACCA TGG Intergenic
No off target data available for this crispr