ID: 983276958

View in Genome Browser
Species Human (GRCh38)
Location 4:165629384-165629406
Sequence TAACCATGGCTTAAAACAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983276954_983276958 18 Left 983276954 4:165629343-165629365 CCATTGCATTTATTTCCTATGGC No data
Right 983276958 4:165629384-165629406 TAACCATGGCTTAAAACAATAGG No data
983276956_983276958 -7 Left 983276956 4:165629368-165629390 CCATAAGAAATTGCAATAACCAT No data
Right 983276958 4:165629384-165629406 TAACCATGGCTTAAAACAATAGG No data
983276955_983276958 3 Left 983276955 4:165629358-165629380 CCTATGGCTGCCATAAGAAATTG No data
Right 983276958 4:165629384-165629406 TAACCATGGCTTAAAACAATAGG No data
983276952_983276958 19 Left 983276952 4:165629342-165629364 CCCATTGCATTTATTTCCTATGG No data
Right 983276958 4:165629384-165629406 TAACCATGGCTTAAAACAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983276958 Original CRISPR TAACCATGGCTTAAAACAAT AGG Intergenic
No off target data available for this crispr