ID: 983279667

View in Genome Browser
Species Human (GRCh38)
Location 4:165664810-165664832
Sequence CTGAATAGACTGAGGGACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 179}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983279663_983279667 10 Left 983279663 4:165664777-165664799 CCCTGGAGACAGGAGAAGGAAGA 0: 1
1: 1
2: 11
3: 65
4: 649
Right 983279667 4:165664810-165664832 CTGAATAGACTGAGGGACCATGG 0: 1
1: 0
2: 1
3: 23
4: 179
983279664_983279667 9 Left 983279664 4:165664778-165664800 CCTGGAGACAGGAGAAGGAAGAA 0: 1
1: 0
2: 8
3: 87
4: 804
Right 983279667 4:165664810-165664832 CTGAATAGACTGAGGGACCATGG 0: 1
1: 0
2: 1
3: 23
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983279667 Original CRISPR CTGAATAGACTGAGGGACCA TGG Intergenic
900433313 1:2612936-2612958 CTGAATGGAAGGAGGGAACAGGG + Intronic
902550997 1:17219542-17219564 GTCAAGGGACTGAGGGACCAGGG + Intronic
902743580 1:18457812-18457834 CTGGGTAGACTGAGGGAACAAGG + Intergenic
903751341 1:25623063-25623085 CGGAAGAGACTGAAGGGCCAGGG - Intronic
903829835 1:26168210-26168232 AAGAAAAGACTTAGGGACCATGG - Intergenic
905299603 1:36977622-36977644 CTGGAGAGACTGAGGACCCAAGG + Intronic
907326376 1:53641108-53641130 CTGAATATCTTGGGGGACCACGG + Intronic
908185687 1:61650655-61650677 CTGCTTACACTGAGGGTCCATGG - Intergenic
911476272 1:98377284-98377306 CTGCAGATACTGAGGGACAATGG - Intergenic
912848805 1:113103518-113103540 CTCAATAGATATAGGGACCACGG - Intronic
915677727 1:157547264-157547286 CTGCATAGCCTGAAGGACCTGGG + Intronic
915921742 1:159980968-159980990 CTGCATACACTAAGGGACCAGGG + Intergenic
917389892 1:174523810-174523832 GAGAATAGAATGAGGTACCAGGG - Intronic
917689372 1:177451604-177451626 CTGAAGAGACTGACAGATCAAGG + Intergenic
918041763 1:180917956-180917978 CTGAGTAAATAGAGGGACCATGG - Intronic
918261513 1:182800629-182800651 CTGAAATGCCTGAGGGACCTGGG + Intronic
919377412 1:196811316-196811338 ATGCATAGACAGACGGACCACGG + Intergenic
919389710 1:196967240-196967262 ATGCATAGACAGACGGACCATGG + Intergenic
919649114 1:200128084-200128106 CTGCATATACTGAGGGATGACGG - Intronic
919761465 1:201100647-201100669 CTGACTAGACAGAGGGACAATGG + Intronic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
1063141642 10:3260947-3260969 ATGATTTGGCTGAGGGACCAGGG + Intergenic
1063577827 10:7277962-7277984 CTGAATAAACTGCGGAAACAGGG - Intronic
1065536845 10:26723185-26723207 CTGACCAGACTGAGGGATCGGGG + Intronic
1067081201 10:43213418-43213440 GTGGCTAGACTGAGGGTCCAGGG + Intronic
1068567951 10:58596380-58596402 CTGAATAAACTGAGTACCCATGG + Intronic
1070378547 10:75858173-75858195 CTGAGTAGACAGAGGGGCCAGGG - Intronic
1071411420 10:85400495-85400517 CAGAATAAACAGAAGGACCATGG + Intergenic
1071423586 10:85526354-85526376 CTTCATAGACTGGGGAACCAAGG - Intergenic
1075542454 10:123326428-123326450 CTGAATAGACTCAAGGACACTGG - Intergenic
1078636580 11:13056051-13056073 CTGAATAAACTGATATACCAGGG - Intergenic
1080733829 11:34989555-34989577 TTGAAAAGACTGTGGGATCATGG + Intronic
1080767455 11:35309891-35309913 CTGAGCCTACTGAGGGACCAAGG + Intronic
1082738542 11:56884455-56884477 CTTAAAAGACTGAGGGACCATGG + Intergenic
1083316416 11:61817156-61817178 GTGAATGGACTGAGGGGCCAGGG + Exonic
1084012296 11:66359152-66359174 ATGAATAAACTGAGGTTCCATGG - Intronic
1084658835 11:70535525-70535547 ATGAATAGACTGATGGATGATGG - Intronic
1085418650 11:76336987-76337009 CAGAAAAGAATGAGAGACCAAGG - Intergenic
1085752327 11:79172340-79172362 CTAAAGAGACTGGGTGACCAGGG + Intronic
1085894995 11:80628590-80628612 CTGAATAGACTGGAAGTCCAAGG + Intergenic
1087267844 11:96080347-96080369 CTGAAAAGAGTGAGGGAAAAGGG + Intronic
1087443754 11:98219562-98219584 ATAAATAGACTGACTGACCAGGG - Intergenic
1088035633 11:105310621-105310643 CTGAATAGAAAGATGGAACAGGG - Intergenic
1089671323 11:120058825-120058847 CTGAGTGGACTGAGGGGCCTGGG + Intergenic
1089718399 11:120387103-120387125 CTGAATAGAATCATGAACCAAGG - Intronic
1093799596 12:23357190-23357212 ATTAATAGACTGAGAGACAAGGG - Intergenic
1095604413 12:44049990-44050012 CTGATTAGCCTGGGGGATCAAGG + Intronic
1096980515 12:55725958-55725980 GGGAAGAGACTGATGGACCAAGG - Intronic
1097441360 12:59612396-59612418 CTGCATAGAGTGGGGGACCCTGG + Intronic
1098196860 12:68011511-68011533 ATGAATAGAAAGAAGGACCATGG + Intergenic
1101602320 12:106221469-106221491 CTGAAGACATTGAGGGTCCAGGG - Intergenic
1102171782 12:110847973-110847995 GTGAATAGACTGAGGCCCAAGGG + Intronic
1103665868 12:122565215-122565237 CTCAAGAGAAAGAGGGACCAAGG - Intronic
1105205645 13:18221390-18221412 GTGACTACACTGAGGGACCAGGG - Intergenic
1106639107 13:31564400-31564422 CTGAATAAGATGAGGGACCCAGG + Intergenic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107224881 13:38036608-38036630 CTGCATAGACTGAGGGAGAGAGG - Intergenic
1109456871 13:62604268-62604290 ATGAATGGAATGAGGGTCCAGGG + Intergenic
1109789505 13:67228908-67228930 CTGAAAAGACTGAGGGAGGTAGG - Intronic
1110280149 13:73683469-73683491 CTGAAAGCTCTGAGGGACCAGGG + Intergenic
1112306031 13:98274404-98274426 CAGAAGAGACTGAGGGAGGAAGG + Intronic
1114404636 14:22444899-22444921 CTGAAAATACAGAGGGACTACGG - Intergenic
1115931611 14:38503199-38503221 TTGAAAAGACTGAGGGCTCAGGG - Intergenic
1116037196 14:39641109-39641131 TTGAATAGACTGAAGTAGCATGG - Intergenic
1118492185 14:66271960-66271982 CTGAATGGACTGAAGGGCAAGGG + Intergenic
1119251979 14:73164126-73164148 CTGACTAGACAGAGGTACTAAGG + Intronic
1119527535 14:75334123-75334145 CTGAATACCCCGAGGGGCCAGGG + Intergenic
1120127691 14:80765443-80765465 CTGAATTGACTGAAAGACCAGGG - Intronic
1121681295 14:95794814-95794836 CAGAATGCACTGAGGGATCAAGG + Intergenic
1122726726 14:103760396-103760418 TTGAATTGCCTGAGGGAACAGGG - Intronic
1127825868 15:62702245-62702267 CTGCATCCACTGGGGGACCATGG + Intronic
1128460338 15:67862109-67862131 TTGAGTAGATTCAGGGACCAGGG + Intergenic
1128502954 15:68241594-68241616 CTGAGGACACTGAGAGACCAAGG + Intronic
1129107009 15:73317634-73317656 CAGAAGAGAATGAGGGACCCTGG + Intergenic
1129925458 15:79359680-79359702 CTGAAGAGATTGAGAGATCAAGG + Intronic
1131059556 15:89396088-89396110 CTGTATAGGCTGGGGGCCCAAGG - Intergenic
1137671707 16:50283107-50283129 CTGAACCCACTGAGGGGCCACGG + Intronic
1140935386 16:79665091-79665113 AAGAATAAACTGAGTGACCAAGG - Intergenic
1143203828 17:5129854-5129876 CTGGTTAGACTGAAGGGCCATGG + Intronic
1143870387 17:9954018-9954040 CTGGAAGGACTGAGGGTCCAGGG + Intronic
1144875008 17:18392966-18392988 CTGGTTAGACTGAAGGGCCATGG + Intergenic
1145157216 17:20551455-20551477 CTGGTTAGACTGAAGGGCCATGG - Intergenic
1147896062 17:43752133-43752155 CTGAGGAGACTGAAGCACCAAGG - Intergenic
1152990697 18:361326-361348 ATGACTAGAGAGAGGGACCATGG - Intronic
1153177199 18:2390010-2390032 CTGAATTGATTGAGAGATCATGG - Intergenic
1156866657 18:41896116-41896138 AAGAATTGACTGAGGGAGCATGG + Intergenic
1157966645 18:52216229-52216251 CTGCATAGAGTGAGATACCAGGG + Intergenic
1158668949 18:59457391-59457413 CTGAATAGGCTCAGCGACCTTGG + Intronic
1159083619 18:63762097-63762119 CTTAGTGGACTGTGGGACCATGG + Intronic
1160301457 18:77684544-77684566 CAGACTAGACAGAGGGAGCAAGG + Intergenic
1160622594 18:80181281-80181303 CTGACTTGGCTGAGGGACCAGGG - Intronic
925083821 2:1091915-1091937 CTAAATAGGCTGAGGGAGCCTGG - Intronic
925211862 2:2056257-2056279 CTGGAGAGCCTGAGGGACCCAGG - Intronic
925970592 2:9104012-9104034 CTCAGTAGACAGAGAGACCAGGG - Intergenic
927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG + Intronic
928025736 2:27737043-27737065 CTGAGTTTACTGTGGGACCATGG - Intergenic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
929847209 2:45542177-45542199 CTGAACAGGCTGAGGCAGCAGGG + Intronic
931135835 2:59399515-59399537 CTGTAGAAACTGTGGGACCAGGG - Intergenic
931398353 2:61908127-61908149 CTGATTAGTCTGAGGAACGAAGG + Intronic
931642666 2:64395540-64395562 CTGAAGACACTGTGGGTCCATGG + Intergenic
932119922 2:69088971-69088993 CAGGATAGACTTAGGGACCAGGG + Intronic
933524833 2:83423099-83423121 GTGAACAGACTGAGGGACATTGG + Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938115999 2:128603332-128603354 CTGTACAGTCTGAGGGACCCAGG + Intergenic
938945522 2:136208650-136208672 TGGAATAGACAGAGGGAACAGGG + Intergenic
939234302 2:139471080-139471102 CTGAATATACCAATGGACCATGG - Intergenic
940048923 2:149440220-149440242 CTGGATAGGCTCAGTGACCAGGG - Intronic
941115694 2:161469744-161469766 CTGAATAGAAGGAGGGAAAATGG + Intronic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
945902309 2:215552791-215552813 CTGAATATACTGAGGGTATAAGG - Intergenic
947388091 2:229612344-229612366 CTGGATACACTGGGGGACCCTGG + Intronic
948282082 2:236754593-236754615 CTGAATAGAATGAAAGACCCAGG - Intergenic
1171282501 20:23912464-23912486 CTGAATAAACAGAGAGACCCTGG - Intergenic
1174347020 20:49937506-49937528 GTGAATACACTGAGGGTCCGAGG + Intronic
1174379204 20:50146021-50146043 GGGAATAGAGGGAGGGACCAGGG - Intronic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1178011570 21:28292324-28292346 CTGAAGAGACTGAAGCAGCAGGG - Intergenic
1178731977 21:35112255-35112277 ATGAAAAGACTGAGGTACAAAGG + Intronic
1180760321 22:18197325-18197347 GTGACTACACTGAGGGACCAGGG + Intergenic
1180770634 22:18381623-18381645 GTGACTACACTGAGGGACCAGGG + Intergenic
1180775348 22:18427371-18427393 GTGACTACACTGAGGGACCAGGG - Intergenic
1180808419 22:18738425-18738447 GTGACTACACTGAGGGACCAGGG - Intergenic
1180828577 22:18884581-18884603 GTGACTACACTGAGGGACCAGGG + Intergenic
1181071346 22:20343390-20343412 GTGACTACACTGAGGGACCAGGG - Intergenic
1181194419 22:21172340-21172362 GTGACTACACTGAGGGACCAGGG - Intergenic
1181215023 22:21320438-21320460 GTGACTACACTGAGGGACCAGGG + Intergenic
1182103600 22:27673843-27673865 CTGAAGGGACAGAGGGACCTGGG - Intergenic
1182594192 22:31405521-31405543 ATGAATAAACTGAGGGAAAAAGG - Intronic
1183467298 22:37986193-37986215 CTGGATGGACAGAGGGACGAGGG + Intronic
1184347557 22:43923087-43923109 CTGAACGGACTAAGGGACTAAGG + Intergenic
1184656738 22:45945754-45945776 CTGGACAGCCTGAGGGGCCAAGG - Intronic
1203232469 22_KI270731v1_random:122795-122817 GTGACTACACTGAGGGACCAGGG + Intergenic
1203278671 22_KI270734v1_random:110570-110592 GTGACTACACTGAGGGACCAGGG + Intergenic
949856741 3:8468820-8468842 CTGAAGTGCCTGAGAGACCAAGG - Intergenic
954447189 3:50553132-50553154 CTGAGGAGCCTGAGGGATCAGGG + Intergenic
954901291 3:54022204-54022226 CAGGATAGACAGAGGGAACAGGG + Intergenic
955579207 3:60400745-60400767 CTGAAAAGACTGAGGAACTTAGG + Intronic
959397829 3:105863701-105863723 CTAAATAGACTGAGGGCAAAAGG + Intronic
963102129 3:141617948-141617970 CTGAATAGGATGAGGGGTCAAGG + Intergenic
971396569 4:26233454-26233476 CTGAAGAGACTGGGGAATCAGGG - Intronic
971471348 4:27030324-27030346 CTGAATTGCCTGATGGCCCAAGG + Intergenic
974167629 4:58224302-58224324 CTTGATAGACTGAGGAAACATGG + Intergenic
975445545 4:74460202-74460224 CTGAATAGAGTGAGAGATAAGGG + Intergenic
977305032 4:95313025-95313047 ATGGACAGATTGAGGGACCATGG + Intronic
977889535 4:102292431-102292453 CAGAATAGACTAAGAGAACAGGG - Intronic
978013439 4:103715477-103715499 CTGTATAGCCTGGGGAACCATGG + Intronic
978543225 4:109841477-109841499 CTGAGTAGACTGAGTGGACAGGG + Intronic
982522415 4:156435483-156435505 GTGAAAAGACTGACGGAGCATGG - Intergenic
983279667 4:165664810-165664832 CTGAATAGACTGAGGGACCATGG + Intergenic
983409403 4:167377818-167377840 CTTAATAGACTGAGAAACAATGG - Intergenic
984822909 4:183898658-183898680 CTGAATGGGCAGAGGTACCATGG + Intronic
985606015 5:858417-858439 CAGGATAGATTCAGGGACCACGG - Intronic
991507567 5:67341426-67341448 CAGAACATACTTAGGGACCATGG - Intergenic
1001443007 5:171760456-171760478 TTGAATAGACTAAGGTAACAGGG - Intergenic
1001702402 5:173716590-173716612 CTGAACAGACTGAGGGATGGAGG - Intergenic
1002360887 5:178669907-178669929 CGGAATAGACTAAGGGACAAAGG + Intergenic
1005076865 6:21917076-21917098 CTGAATTAACTGAGGGTCTAGGG - Intergenic
1005799971 6:29410607-29410629 CTGGAGAGTCTGTGGGACCAAGG + Intronic
1005986905 6:30881315-30881337 GTGAATGGGCTGAGGGACTAGGG + Intronic
1011308992 6:85960517-85960539 CTGAAGTGACTCAGGGACCTAGG + Intergenic
1011445342 6:87433146-87433168 CTGAATAAAATGAGGCAGCAAGG - Intronic
1013844207 6:114429853-114429875 CTGTATAGACTGAGGAATTAAGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1022386825 7:29907821-29907843 CTGAAAAGACTAAGACACCATGG + Intronic
1025211554 7:57021882-57021904 CTTAATAGACGAAGAGACCAAGG + Intergenic
1025660401 7:63554965-63554987 CTTAATAGACGAAGAGACCAAGG - Intergenic
1026327146 7:69320601-69320623 CTGAACAGACTGCTGGGCCATGG - Intergenic
1030359090 7:108576539-108576561 CAGAATAGACAGAGGGGCAATGG + Intergenic
1033286894 7:140049202-140049224 CTGAGAGGACTGAGGGAACAAGG + Intronic
1037346723 8:17909025-17909047 CTGATTAGACTGAAGAAGCATGG + Intronic
1038071491 8:24019124-24019146 GTAAAAAGTCTGAGGGACCACGG + Intergenic
1038313732 8:26465435-26465457 CTTAATAGTCAGAGGGACCAGGG - Intronic
1038689399 8:29747453-29747475 CTGAATAGACTTGGGGAATATGG - Intergenic
1040877091 8:52165336-52165358 CTGAATAGAGAGAGAGAGCATGG - Intronic
1041023926 8:53665261-53665283 CTGTACAGCCTGAGGGACCCTGG + Intergenic
1041703967 8:60825473-60825495 GTGAATAGTCTCAGGGACCTTGG + Intronic
1044278290 8:90327503-90327525 TTAGATAGACCGAGGGACCACGG - Intergenic
1046953587 8:120041317-120041339 CTGGATAGACTGAGTGCCCATGG - Intronic
1047135470 8:122073069-122073091 CTGGCTAGACTGTGAGACCAGGG - Intergenic
1047171009 8:122492257-122492279 CTGAGCAGACTGAGGCACTAGGG - Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1049831564 8:144704512-144704534 CGGCAGAGACTGAGAGACCAAGG + Intergenic
1050654964 9:7818036-7818058 CAAAATAGACTAAGGCACCAAGG - Intronic
1051336617 9:16071434-16071456 CTGGAAAGTCTGAGGGAGCAAGG - Intergenic
1053285505 9:36847469-36847491 CTGACGAGACTGAGGCCCCAGGG - Intronic
1055023504 9:71694950-71694972 CTAGAGTGACTGAGGGACCATGG - Intronic
1055417979 9:76104928-76104950 ATGCATTGACTTAGGGACCAGGG + Intronic
1055696672 9:78892316-78892338 GTGAATAATCTGAGGAACCAAGG - Intergenic
1056062665 9:82900155-82900177 CTGAATAAACTGAGCCAGCAAGG - Intergenic
1058534984 9:105949880-105949902 CTGGAGAGTCTGTGGGACCAGGG - Intergenic
1059366322 9:113789244-113789266 CTGAGGACACTGAGAGACCAAGG - Intergenic
1059404019 9:114088981-114089003 CTGCATAGACTCAGGAGCCAAGG + Intronic
1060390208 9:123270224-123270246 CTCAAGGGACTGAGAGACCAGGG - Intergenic
1060660773 9:125404058-125404080 TTGAAGGGACTGAGGGACCCTGG - Intergenic
1186412499 X:9356337-9356359 CTGACGGGACTGAGGGACAAAGG + Intergenic
1188293491 X:28417393-28417415 CTGAATGGACTGATGCAGCATGG - Intergenic
1188837959 X:34981775-34981797 CTGAATAGAATGAGGTAAAAGGG - Intergenic
1189229330 X:39440047-39440069 CTGAACAGGCTGAGGGAACAGGG + Intergenic
1192233123 X:69279335-69279357 CAGAAGAGACAGAGGGAACAGGG - Intergenic
1196299291 X:114036593-114036615 CTGTATAAACTGTGGGCCCAGGG - Intergenic
1197303616 X:124812656-124812678 ATGAATAGACTGTGGTAACAAGG + Intronic
1198450764 X:136765417-136765439 CTGAATAGAGTGAGTAGCCAGGG - Intronic