ID: 983279960

View in Genome Browser
Species Human (GRCh38)
Location 4:165667933-165667955
Sequence CTGAAAGATGACTTGAAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983279960_983279964 -3 Left 983279960 4:165667933-165667955 CCAGTCTTCAAGTCATCTTTCAG No data
Right 983279964 4:165667953-165667975 CAGATTCACCAGAGGGAAAAGGG No data
983279960_983279962 -10 Left 983279960 4:165667933-165667955 CCAGTCTTCAAGTCATCTTTCAG No data
Right 983279962 4:165667946-165667968 CATCTTTCAGATTCACCAGAGGG No data
983279960_983279963 -4 Left 983279960 4:165667933-165667955 CCAGTCTTCAAGTCATCTTTCAG No data
Right 983279963 4:165667952-165667974 TCAGATTCACCAGAGGGAAAAGG No data
983279960_983279965 -2 Left 983279960 4:165667933-165667955 CCAGTCTTCAAGTCATCTTTCAG No data
Right 983279965 4:165667954-165667976 AGATTCACCAGAGGGAAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983279960 Original CRISPR CTGAAAGATGACTTGAAGAC TGG (reversed) Intergenic
No off target data available for this crispr