ID: 983279964

View in Genome Browser
Species Human (GRCh38)
Location 4:165667953-165667975
Sequence CAGATTCACCAGAGGGAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983279960_983279964 -3 Left 983279960 4:165667933-165667955 CCAGTCTTCAAGTCATCTTTCAG No data
Right 983279964 4:165667953-165667975 CAGATTCACCAGAGGGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983279964 Original CRISPR CAGATTCACCAGAGGGAAAA GGG Intergenic
No off target data available for this crispr