ID: 983287526

View in Genome Browser
Species Human (GRCh38)
Location 4:165758798-165758820
Sequence CTGTTAGGATGCAGAAGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983287523_983287526 0 Left 983287523 4:165758775-165758797 CCAGCCATCTTCTGCATCATTTT No data
Right 983287526 4:165758798-165758820 CTGTTAGGATGCAGAAGAAAAGG No data
983287522_983287526 20 Left 983287522 4:165758755-165758777 CCAGGGTAGTTTTCAGAGCTCCA No data
Right 983287526 4:165758798-165758820 CTGTTAGGATGCAGAAGAAAAGG No data
983287521_983287526 21 Left 983287521 4:165758754-165758776 CCCAGGGTAGTTTTCAGAGCTCC No data
Right 983287526 4:165758798-165758820 CTGTTAGGATGCAGAAGAAAAGG No data
983287524_983287526 -4 Left 983287524 4:165758779-165758801 CCATCTTCTGCATCATTTTCTGT No data
Right 983287526 4:165758798-165758820 CTGTTAGGATGCAGAAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983287526 Original CRISPR CTGTTAGGATGCAGAAGAAA AGG Intergenic
No off target data available for this crispr