ID: 983290189

View in Genome Browser
Species Human (GRCh38)
Location 4:165792890-165792912
Sequence TCCAGGACTTTCATAGCTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983290189_983290192 0 Left 983290189 4:165792890-165792912 CCTATAGCTATGAAAGTCCTGGA No data
Right 983290192 4:165792913-165792935 CGGCGTCTTCTTCCAATAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983290189 Original CRISPR TCCAGGACTTTCATAGCTAT AGG (reversed) Intergenic
No off target data available for this crispr