ID: 983293346

View in Genome Browser
Species Human (GRCh38)
Location 4:165834335-165834357
Sequence ATGTTGGCAGAGAGAGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983293338_983293346 16 Left 983293338 4:165834296-165834318 CCAATTATGTAAAGCAGCATGAG No data
Right 983293346 4:165834335-165834357 ATGTTGGCAGAGAGAGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983293346 Original CRISPR ATGTTGGCAGAGAGAGAGGG AGG Intergenic
No off target data available for this crispr