ID: 983296339

View in Genome Browser
Species Human (GRCh38)
Location 4:165873533-165873555
Sequence GCTCGCCGAGCCGCGGCCGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 175}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983296330_983296339 12 Left 983296330 4:165873498-165873520 CCGAGCTCTGGTGGCAGCTGAGC 0: 1
1: 0
2: 1
3: 31
4: 397
Right 983296339 4:165873533-165873555 GCTCGCCGAGCCGCGGCCGCGGG 0: 1
1: 0
2: 2
3: 19
4: 175
983296334_983296339 -10 Left 983296334 4:165873520-165873542 CCCGCGGGGCGCCGCTCGCCGAG 0: 1
1: 0
2: 0
3: 4
4: 82
Right 983296339 4:165873533-165873555 GCTCGCCGAGCCGCGGCCGCGGG 0: 1
1: 0
2: 2
3: 19
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983296339 Original CRISPR GCTCGCCGAGCCGCGGCCGC GGG Exonic
900180132 1:1307659-1307681 CCGGGCCGGGCCGCGGCCGCCGG - Intronic
900237634 1:1600212-1600234 CCTCGCCGGGCCGCGGCCTACGG + Intergenic
901066613 1:6497392-6497414 GGCCGCAGAGCCGCCGCCGCCGG + Intronic
902823255 1:18956264-18956286 GCCCGCCGGGCGGCGGCGGCGGG - Exonic
904782980 1:32964508-32964530 GCAGGCCGAGCCGCCGCCCCCGG - Exonic
905819855 1:40980417-40980439 GCGCCCCGACCCCCGGCCGCCGG - Intronic
905960058 1:42035809-42035831 GCGCGCCGGGCCGGGGCGGCGGG + Intronic
906407087 1:45550742-45550764 GCGCGCCTAGGCGCCGCCGCAGG - Exonic
907160969 1:52368631-52368653 GGTCCCCGAGCCGCGGCGGGGGG - Intergenic
907905673 1:58782513-58782535 GCGCGCTGAGCAGCGGCGGCGGG - Exonic
912775181 1:112502288-112502310 GCTCCCCGGGCCGCGGCCCTGGG + Intronic
916412398 1:164559256-164559278 TCTCCCCCAGCCGCGGCGGCAGG - Intronic
922496666 1:226062780-226062802 GCTCGCCGAGCTCCAGCCGAAGG + Intronic
922586410 1:226737555-226737577 GCGCGCGGAGCCGCGGCTGCCGG - Exonic
1065025317 10:21534891-21534913 CCGCCCCGTGCCGCGGCCGCGGG + Intronic
1070570901 10:77638578-77638600 GCTTGCCGGGCCGCTGCCGAGGG - Intronic
1074772367 10:116742388-116742410 GCCCCGCCAGCCGCGGCCGCAGG + Intronic
1075106611 10:119543398-119543420 GCTAGCCGAGCCGCCGCGGGTGG + Intergenic
1075129525 10:119726169-119726191 GCTCCCCGAGGCGCGGGCTCTGG + Exonic
1076554079 10:131311130-131311152 TCTCGCCGAGGCACGGCTGCCGG + Intronic
1081863543 11:46347586-46347608 GCGTGCTGAGCCCCGGCCGCCGG + Intronic
1081908110 11:46681995-46682017 GCTGGCAGAGCCGCTGCCTCTGG + Intronic
1091473848 12:753146-753168 GCTCGGCGAGCGGCGGCAGTGGG + Exonic
1092462344 12:8697847-8697869 GCCCGCCGCGCCGCGGCGCCAGG + Intronic
1095875873 12:47079775-47079797 GCTCCCAGAGCCGGGGCCGCGGG + Exonic
1098029050 12:66235414-66235436 TCTCGCCGCGCGGCGGCGGCCGG + Intronic
1101466797 12:104957967-104957989 GCTCCCCGCGCCCCCGCCGCCGG + Intronic
1101910476 12:108857368-108857390 GGACGCCGCGCCGAGGCCGCCGG - Intronic
1102854016 12:116277699-116277721 GCGGGCCGAGCCGCGGTCGGCGG - Intergenic
1103749771 12:123150840-123150862 GCCGGCCGGGCCGGGGCCGCGGG - Intergenic
1104865326 12:131950103-131950125 GGTCGCGTAGCCGCAGCCGCGGG + Intronic
1104918263 12:132277653-132277675 GCCAGCAGAGCCGGGGCCGCGGG - Intronic
1104929195 12:132329355-132329377 GCGCGCCGGGCCACGGCCGCCGG + Intergenic
1105943406 13:25170686-25170708 GCGCGCCGAGCCGGGGCCCGGGG - Exonic
1107787046 13:43968350-43968372 GCGTGCTGAGCCCCGGCCGCCGG + Intergenic
1108086315 13:46797040-46797062 CCTAGCCGTGCCGCAGCCGCAGG + Intronic
1111672763 13:91348995-91349017 GGTCGCCGCGCGGCTGCCGCCGG + Intergenic
1112271905 13:97976486-97976508 TCTCACCCCGCCGCGGCCGCCGG - Intronic
1112365604 13:98752710-98752732 GCTCTGCGAGGCGGGGCCGCCGG + Intergenic
1113379302 13:109787266-109787288 GCTCGCGAACCCGCGGCCGCGGG - Intergenic
1116887104 14:50231912-50231934 GCGGGCCGAGCCTCGGCTGCTGG - Intergenic
1117377381 14:55129097-55129119 ACACCCCGAGCCGCCGCCGCAGG - Exonic
1119330137 14:73787302-73787324 GCGCGCGGAGCCGGGGGCGCGGG - Intronic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1119701951 14:76761689-76761711 GCTCGCGCAGCCTCGGCCGGCGG - Intergenic
1122736659 14:103847468-103847490 GCTGGCCCTGTCGCGGCCGCCGG + Exonic
1122904472 14:104795514-104795536 CCTAGCCGGGCCGCGGCCTCCGG + Intronic
1124848070 15:33310977-33310999 GCACGCCGAGCGGCTGCCGGGGG + Exonic
1125329181 15:38565174-38565196 GTGCTCCGAGCAGCGGCCGCAGG - Intronic
1128269138 15:66293561-66293583 GCCCGCCACTCCGCGGCCGCCGG + Exonic
1128322443 15:66703056-66703078 GCTCGCCGAGGCGGGACGGCCGG - Exonic
1128423982 15:67521225-67521247 GCCCGCCGCGCCGGGGACGCAGG - Exonic
1130348017 15:83066898-83066920 GGTCGCGGCGCCGCCGCCGCTGG - Exonic
1131272810 15:90957204-90957226 GCGCGCCGGGCCGGGGCCGGAGG + Exonic
1131977520 15:97961073-97961095 GCTGGCCGAGGCGCGGGGGCAGG - Exonic
1132365092 15:101251471-101251493 GCCCGCCGGGCCGCCGCCGCAGG + Exonic
1132871075 16:2116016-2116038 GCCCGCCCAGCTGCGGCTGCAGG - Exonic
1134521459 16:14920878-14920900 GCCCGCCCAGCTGCGGCTGCAGG + Intronic
1134709130 16:16319529-16319551 GCCCGCCCAGCTGCGGCTGCAGG + Intergenic
1134716339 16:16359558-16359580 GCCCGCCCAGCTGCGGCTGCAGG + Intergenic
1134950475 16:18349116-18349138 GCCCGCCCAGCTGCGGCTGCAGG - Intergenic
1134958411 16:18392601-18392623 GCCCGCCCAGCTGCGGCTGCAGG - Intergenic
1135382731 16:22008123-22008145 GCGGGCCGCGCCGCGGCTGCTGG + Intronic
1136699216 16:32116534-32116556 GCCCTCAGAGCCGCGGCGGCGGG - Intergenic
1136768437 16:32811400-32811422 GCCCTCAGAGCCGCGGCGGCGGG + Intergenic
1136799707 16:33059705-33059727 GCCCTCAGAGCCGCGGCGGCGGG - Intergenic
1136902137 16:34050969-34050991 GCCCTCAGAGCCGCGGCGGCTGG - Intergenic
1137530907 16:49278255-49278277 GCTAGGCCAGGCGCGGCCGCCGG - Exonic
1139361514 16:66402671-66402693 GCTTCCGGAGCCGCCGCCGCAGG - Exonic
1141830749 16:86508896-86508918 GCTCGGCCTGCCGCCGCCGCGGG - Intergenic
1142037164 16:87869452-87869474 GCTCGCTGGGCCGCGGCTCCCGG - Exonic
1142400922 16:89858435-89858457 GCACGCGGGGCCGCGGGCGCTGG - Exonic
1203070829 16_KI270728v1_random:1073416-1073438 GCCCTCAGAGCCGCGGCGGCGGG + Intergenic
1142623660 17:1179728-1179750 TCTGACCGAGCCGCCGCCGCGGG - Exonic
1142876398 17:2853932-2853954 GCGCGCGGAGCCGGGGCTGCGGG + Intronic
1144840637 17:18183785-18183807 GCGCGCGGAGCCGCGGTGGCCGG + Intronic
1145094018 17:20009371-20009393 GCGCCCGGAGCCGTGGCCGCTGG + Intronic
1145765507 17:27456258-27456280 GCCTGCCTCGCCGCGGCCGCCGG + Intergenic
1146126538 17:30235827-30235849 GAGCGCGGAGCCGCGGCCGCGGG - Exonic
1146208308 17:30922774-30922796 GGTCGCCGCGCAGCGGCCGGTGG + Intronic
1146794285 17:35770224-35770246 GGTCCCTGAGCCGCCGCCGCGGG - Exonic
1148183145 17:45620798-45620820 GCGAGCCGGGCAGCGGCCGCGGG + Intergenic
1148262237 17:46193548-46193570 GCCCGCCGCGCCGCCCCCGCGGG + Intronic
1150423286 17:65056950-65056972 GCGCGCCCGGCCGCGGCTGCGGG - Intergenic
1150904831 17:69326754-69326776 CCTCGCGGAGCCCCCGCCGCAGG + Intronic
1151801732 17:76383289-76383311 GCGCGCGGAGCTGCGGCCCCAGG + Intronic
1152711184 17:81871147-81871169 GCCCGCCGAGACCCTGCCGCGGG + Intronic
1153515163 18:5895440-5895462 CCGCCCCGAGCCGCCGCCGCGGG - Exonic
1154518342 18:15197903-15197925 GCCCTCAGAGCCGCGGCGGCGGG + Intergenic
1155152862 18:23136125-23136147 GCTCGCCGCGCCGGGCACGCCGG + Exonic
1156008601 18:32471031-32471053 GCGCGCCGAGCCGCGGGCGCTGG - Intergenic
1160511767 18:79456875-79456897 GCTGCCCGTGCCGCGGACGCTGG - Intronic
1160577247 18:79863684-79863706 GCTCCCCGGGCGGCGGCGGCGGG + Exonic
1160724977 19:613867-613889 GCTCGCCGTGCGGCGGCCCCGGG - Exonic
1160767026 19:813247-813269 GCGCGCGGGGCCGCCGCCGCTGG - Exonic
1161031860 19:2061342-2061364 GCGCCCAGAGCCCCGGCCGCCGG - Intergenic
1161573326 19:5041944-5041966 GCTCTCTGAGCCGAGGGCGCCGG + Intronic
1162100332 19:8335070-8335092 GCTCGGTGAGCCGCCGCAGCTGG + Exonic
1162100400 19:8335359-8335381 GCGCGCCCAGCCCCGGCCGCGGG - Exonic
1165495824 19:36151603-36151625 GCGCGCCGAGCCGGGGCAGGCGG - Intronic
1168339815 19:55616468-55616490 GCTCGCCCAGGTGCAGCCGCTGG - Exonic
925027618 2:621774-621796 ACTCGCCAGGACGCGGCCGCAGG - Intergenic
925927158 2:8678781-8678803 GCTCGCCCAGGCCCGGCCGCCGG - Intergenic
926202603 2:10812583-10812605 CCCCGGCGGGCCGCGGCCGCAGG - Intronic
927215858 2:20667456-20667478 GCGCGCCGCGCCGCGGGCTCCGG + Exonic
927759820 2:25742926-25742948 GCTCTCTGAGCCCCGGCCGTAGG + Exonic
928927919 2:36597712-36597734 GCTGGGCGAGCCGAGGCCGACGG + Intronic
932607655 2:73175773-73175795 GCTTGCAGAGCCGGGGCCCCGGG + Intergenic
935137876 2:100322747-100322769 GCTCGCTGAGGCGGGGCCTCTGG - Intergenic
935622827 2:105144086-105144108 GCTCCCCGAGCCGCAGCTGCCGG - Intergenic
936141848 2:109947806-109947828 CCTCGCCGGGCTGCGGGCGCAGG - Intergenic
936178536 2:110245754-110245776 CCTCGCCGGGCTGCGGGCGCAGG - Intergenic
936202842 2:110423678-110423700 CCTCGCCGGGCTGCGGGCGCAGG + Exonic
937418658 2:121737222-121737244 GCGTGCCGAGGCGCGGCAGCGGG + Intronic
939869042 2:147507005-147507027 GCACTCTGAGCCGCGGGCGCCGG + Intergenic
941020966 2:160407655-160407677 TCTCGCCGCGCGGCGGCGGCCGG + Intronic
942319044 2:174719853-174719875 GCTCGCCGAGCTCCAGCCGAAGG + Intergenic
947641660 2:231710533-231710555 GCTCGCCGGACAGCGGCCGAGGG + Intronic
948467453 2:238159111-238159133 CCTCGAGGAGCCGCGCCCGCAGG + Exonic
1175439480 20:58980994-58981016 GCTCGCAGAGCCGGCGCCGCAGG + Intergenic
1176199858 20:63855350-63855372 CCTCCCCGAGCTGTGGCCGCAGG + Intergenic
1178981457 21:37268065-37268087 CCTCTCGGAGCCGCGGGCGCTGG + Intergenic
1179411798 21:41168190-41168212 AGTCGCTGAGCCGCGGCTGCCGG + Exonic
1181813710 22:25421139-25421161 GCGCGGCGGGCGGCGGCCGCGGG + Intergenic
1182422624 22:30256019-30256041 GCTGGCGGGGCCGTGGCCGCAGG - Intergenic
1183691040 22:39388614-39388636 TCTCGCTGAGCAGCGGCCTCAGG - Intergenic
1185056274 22:48580052-48580074 GTACACCGTGCCGCGGCCGCTGG - Intronic
1185314003 22:50170963-50170985 GCGCCCCGCGCCCCGGCCGCCGG - Intronic
950765438 3:15269775-15269797 CCTGGCCGAGCAGCGGCTGCTGG - Exonic
951231665 3:20186374-20186396 GGTCGCCGAGACCCGACCGCAGG - Intergenic
953032748 3:39188845-39188867 GCTCTTTGAGACGCGGCCGCTGG - Exonic
953149398 3:40310168-40310190 CCTCTCGGAGCCCCGGCCGCGGG + Intronic
953246640 3:41199601-41199623 CCCCGCCGAGCCGCCACCGCAGG + Exonic
960096756 3:113696674-113696696 GCTTGCTGAGCTGCGGCCGCGGG - Intergenic
962367493 3:134795957-134795979 GCTCTCCGAGCGGGGGCTGCGGG - Intronic
968225299 3:196969049-196969071 GTTCGCCGAGGAGGGGCCGCCGG - Intronic
968512662 4:1002481-1002503 GCTGGGTGAGCCGGGGCCGCTGG + Exonic
968671902 4:1856416-1856438 GCTCGCAGCGTGGCGGCCGCAGG + Intergenic
980986344 4:139698587-139698609 GCTCGCCGAGCTCCAGCCGAAGG - Intronic
981429798 4:144645871-144645893 GCCCGCCTCGCCGCGGCCCCCGG - Intergenic
981782860 4:148445485-148445507 CCCCGCCGAGCCGCCTCCGCGGG - Intergenic
983296339 4:165873533-165873555 GCTCGCCGAGCCGCGGCCGCGGG + Exonic
985580486 5:693233-693255 GCCCCCCGCGCCGCGCCCGCGGG + Intronic
985595144 5:784623-784645 GCCCCCCGCGCCGCGCCCGCAGG + Intergenic
987193242 5:15500354-15500376 GCTCACCGCGCCGCCGCCGCCGG - Exonic
988823979 5:34915924-34915946 GCGCACAGAGCCGCCGCCGCAGG - Exonic
988949379 5:36241800-36241822 GTGGGCCGGGCCGCGGCCGCGGG + Intronic
997583941 5:135033907-135033929 GCGCGCCCAGCCCCGGCCCCTGG - Exonic
998166752 5:139848570-139848592 GCACGCCGTGTCGCTGCCGCCGG - Exonic
999300150 5:150485982-150486004 CCTCCCCGAATCGCGGCCGCTGG - Intronic
999768178 5:154756070-154756092 GCTGCCGGAGCCGCGGGCGCGGG + Intronic
1001576945 5:172770895-172770917 GCTCCCCCAGCAGCGCCCGCAGG + Exonic
1002029390 5:176416619-176416641 GGTCGCCGAGCAGCGGCCGCAGG + Intergenic
1007630312 6:43269755-43269777 GCCCGAGGAGCCGCCGCCGCCGG - Intronic
1016738912 6:147508405-147508427 CCACGCAGACCCGCGGCCGCTGG - Intergenic
1017282127 6:152636842-152636864 GGGCGCCGGGCCGCGGCCGCCGG - Intronic
1020008072 7:4792677-4792699 GGCCGCTGAGCCGGGGCCGCAGG + Intronic
1022088159 7:27088475-27088497 GCTCGGGCAGCGGCGGCCGCGGG - Intergenic
1025306719 7:57868139-57868161 GCCCTCAGAGCCGCGGCGGCGGG + Intergenic
1025561962 7:62380612-62380634 GCCCTCAGAGCCGCGGCGGCGGG - Intergenic
1025878381 7:65509137-65509159 GCCCTCAGAGCCGCGGCGGCGGG + Intergenic
1025882728 7:65554951-65554973 GCCCTCAGAGCCGCGGCGGCGGG + Intergenic
1025890715 7:65647652-65647674 GCCCTCAGAGCCGCGGCGGCGGG - Exonic
1026470948 7:70694010-70694032 GCGCGCCGAGCCCGAGCCGCCGG - Intronic
1026805107 7:73424393-73424415 GCTCGGGGAGCCCCGGCCACGGG - Intergenic
1033418109 7:141182206-141182228 GCTCGCCGGGCAGCAGCCTCAGG + Intronic
1034418751 7:150978268-150978290 GCTGCCCGAGCCGCGGGCGCTGG - Exonic
1034560626 7:151877329-151877351 CCCCGCCGCGCCGCGGCCCCAGG + Intergenic
1035167442 7:157000051-157000073 GCTCCCCCATCCGCGGCTGCAGG - Intronic
1036454130 8:8893163-8893185 GCTCGGCGGCCGGCGGCCGCGGG + Exonic
1037811385 8:22089155-22089177 CCTCGTCGCGCCGGGGCCGCCGG + Intronic
1038554160 8:28494677-28494699 GGTTGCCGAGCCGCGGGCTCAGG - Intronic
1039542487 8:38382921-38382943 CCTCGGCGAGCCGGCGCCGCCGG - Intergenic
1040038752 8:42896422-42896444 GCCCGCGGAGCCGCGGACGGCGG - Exonic
1042155562 8:65841538-65841560 GCCCGCCCTGCCGCGGCCGCCGG + Exonic
1042591675 8:70403309-70403331 GAGCGCCGAGGCGCGGCCGGGGG - Intronic
1044591404 8:93917162-93917184 GCTCGCGGATCGGCGGCCGCGGG + Exonic
1044988587 8:97775922-97775944 GCCCGCCGCGCCGCTGCTGCCGG - Exonic
1045432135 8:102124112-102124134 GCTCGGTGCGCCGCGGGCGCAGG - Intronic
1049109666 8:140635308-140635330 GCTCGAGGAGCGGCGGCGGCGGG - Intronic
1049354522 8:142181076-142181098 ACTCGCTGAGCCGCGAGCGCTGG + Intergenic
1049605717 8:143528342-143528364 CCTGGCCGAGGCGTGGCCGCTGG - Intronic
1049682172 8:143924282-143924304 GCTCCTCCAGCCGCCGCCGCTGG + Exonic
1049721030 8:144115646-144115668 GCCCGGAGAGCCGCCGCCGCTGG + Exonic
1054775792 9:69122328-69122350 GCCCGCTGAGCCTCCGCCGCGGG + Intronic
1056126231 9:83538383-83538405 GCCCGCCGCGCCCCGGCCGCTGG - Exonic
1056143686 9:83708275-83708297 GCAGGCGCAGCCGCGGCCGCAGG - Intergenic
1057503104 9:95611324-95611346 GCTGGCCCAGCCTCGGCCACAGG + Intergenic
1058053233 9:100427087-100427109 CTTCCCCGAGCTGCGGCCGCCGG - Intergenic
1061002945 9:127912665-127912687 GCTCGCGGACCAGCGGCTGCAGG + Exonic
1062230359 9:135479165-135479187 GCTCGAGGAGCCGCCGCCCCGGG + Intronic
1062325694 9:136011544-136011566 GGCCTCCGGGCCGCGGCCGCCGG + Exonic
1062592082 9:137278717-137278739 GCTCGGGGGGCCGCGGCAGCAGG - Exonic
1188314777 X:28659503-28659525 GCTCGCCGAGCTCCAGCCGAAGG - Intronic
1193085856 X:77447614-77447636 GCGGGCCGAGCCGGGGCCACGGG - Intergenic
1196734949 X:118975056-118975078 GCTCTCCGAGCGGCAGCAGCTGG + Exonic
1197179031 X:123514415-123514437 GCTCGCCGAGCTCCAGCCGAAGG + Intergenic