ID: 983296848

View in Genome Browser
Species Human (GRCh38)
Location 4:165876960-165876982
Sequence AGGAATGGATTACTACTGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983296843_983296848 19 Left 983296843 4:165876918-165876940 CCTTGAGGACAGAGACCATAACT 0: 1
1: 5
2: 22
3: 117
4: 779
Right 983296848 4:165876960-165876982 AGGAATGGATTACTACTGTTAGG No data
983296845_983296848 4 Left 983296845 4:165876933-165876955 CCATAACTGGTTTGTAATGTTTA 0: 1
1: 1
2: 0
3: 16
4: 228
Right 983296848 4:165876960-165876982 AGGAATGGATTACTACTGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983296848 Original CRISPR AGGAATGGATTACTACTGTT AGG Intronic
No off target data available for this crispr