ID: 983298977

View in Genome Browser
Species Human (GRCh38)
Location 4:165901767-165901789
Sequence GTGCTGTTCTGGGAGATCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983298971_983298977 16 Left 983298971 4:165901728-165901750 CCCACTTGAGGAGGCAGTCTGTT 0: 86
1: 2513
2: 4835
3: 1556
4: 592
Right 983298977 4:165901767-165901789 GTGCTGTTCTGGGAGATCCATGG No data
983298972_983298977 15 Left 983298972 4:165901729-165901751 CCACTTGAGGAGGCAGTCTGTTC 0: 61
1: 1982
2: 4522
3: 2190
4: 792
Right 983298977 4:165901767-165901789 GTGCTGTTCTGGGAGATCCATGG No data
983298974_983298977 -7 Left 983298974 4:165901751-165901773 CCTTAGCAGAGCTGGAGTGCTGT 0: 6
1: 142
2: 347
3: 592
4: 728
Right 983298977 4:165901767-165901789 GTGCTGTTCTGGGAGATCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983298977 Original CRISPR GTGCTGTTCTGGGAGATCCA TGG Intronic
No off target data available for this crispr