ID: 983300254

View in Genome Browser
Species Human (GRCh38)
Location 4:165916035-165916057
Sequence CTTTCACCAAACATGAAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 239}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983300254_983300258 14 Left 983300254 4:165916035-165916057 CCTTGTTTCATGTTTGGTGAAAG 0: 1
1: 0
2: 1
3: 23
4: 239
Right 983300258 4:165916072-165916094 TTACTTTCGTCTGTGGACAGAGG 0: 1
1: 0
2: 0
3: 9
4: 136
983300254_983300257 7 Left 983300254 4:165916035-165916057 CCTTGTTTCATGTTTGGTGAAAG 0: 1
1: 0
2: 1
3: 23
4: 239
Right 983300257 4:165916065-165916087 GGTTTAATTACTTTCGTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983300254 Original CRISPR CTTTCACCAAACATGAAACA AGG (reversed) Intronic
903015222 1:20357264-20357286 ATTCCACAAAAGATGAAACAGGG - Intergenic
903757059 1:25669842-25669864 CTTTCACAGGACAAGAAACAAGG + Intronic
904198676 1:28804930-28804952 TTTTCACCATCCAGGAAACATGG + Intergenic
908466430 1:64400796-64400818 TTCTCACCACACATGAAAAAAGG - Intergenic
908551654 1:65214411-65214433 GTTTCATCAGATATGAAACAAGG - Intronic
909106895 1:71422648-71422670 CTGTCAGAAAACATAAAACAAGG - Intronic
909962722 1:81866936-81866958 CTTTTAACAAACATTAAGCAAGG + Intronic
910942695 1:92553999-92554021 GTTTCTCAAAACATCAAACATGG + Intronic
916086171 1:161271335-161271357 ATTTCACCAAAGAAGATACATGG - Intronic
918617014 1:186556473-186556495 CTTCCAACAAACAAGAAACAAGG - Intergenic
921411074 1:214836745-214836767 ATTTCAGCAAACATGCAACCAGG + Intergenic
921553830 1:216572161-216572183 ATTTCACCAAGCATGAAATCAGG - Intronic
921922325 1:220683721-220683743 TTTGCTACAAACATGAAACAAGG - Intergenic
923208932 1:231785709-231785731 GTTTTACAAAACAAGAAACAGGG + Intronic
923519905 1:234727381-234727403 CTTTCACCAATAAGAAAACAGGG - Intergenic
924262103 1:242242582-242242604 CTTTCACCACCCATTAATCACGG + Intronic
1063557814 10:7097253-7097275 CTTCCGCCAAACATGAGACAAGG + Intergenic
1064120061 10:12610817-12610839 CTTTCACCAACAATAAGACAGGG - Intronic
1065103592 10:22356643-22356665 CTTTGACCAAACCAGAAACTTGG + Intronic
1066532343 10:36354524-36354546 CTTTCACTAAACAGTAAACAGGG + Intergenic
1067077448 10:43196337-43196359 CTCCCACCAAACATGCACCAGGG + Intronic
1068009403 10:51428873-51428895 GATTCACCAAAAATTAAACAGGG + Intronic
1068725359 10:60294944-60294966 CTATAACAAAAAATGAAACAAGG + Intronic
1069313244 10:67065666-67065688 CTTTCCCCAAGCATGAGCCACGG + Intronic
1070012238 10:72487435-72487457 CTGTAACCACAGATGAAACATGG + Intronic
1070253899 10:74797699-74797721 CTTTTACCAAAGAGGAACCAAGG - Intergenic
1071073662 10:81726308-81726330 CTTTTACCAAAGATTAAAGAGGG - Intergenic
1071791044 10:88954350-88954372 CTTTTACCAACCAGAAAACACGG + Intronic
1071922047 10:90361401-90361423 CTTTCACCAACTATGAAGCTAGG - Intergenic
1072004025 10:91224897-91224919 GTTTCACCAAGCATGGAACCTGG + Intronic
1074279703 10:112039263-112039285 CTTGTCCTAAACATGAAACATGG - Intergenic
1074922570 10:118031721-118031743 CTTCCACCAAACATTAAAAATGG + Intronic
1076284548 10:129280518-129280540 ATTTCAACAAACAGGAAAAATGG - Intergenic
1078807679 11:14722466-14722488 CTTTTTCCAAAGACGAAACAAGG + Intronic
1080440795 11:32292683-32292705 ATTTCACAAAAGAGGAAACATGG + Intergenic
1081196745 11:40170414-40170436 CTTTCACCAAAGATGTAATTTGG - Intronic
1081216353 11:40404024-40404046 CATTAAGCAAACATGAGACAAGG - Intronic
1082134738 11:48534074-48534096 CTTACAAGAAAAATGAAACAGGG - Intergenic
1082203891 11:49407252-49407274 CATTCACCAAACAAAAATCACGG + Intergenic
1084763066 11:71286375-71286397 GTTTCTCCAAAAATTAAACATGG - Intergenic
1086363482 11:86083815-86083837 CTAACACCAAAAATGAAAGAAGG - Intergenic
1086651202 11:89293269-89293291 CATTCACCAAACAAAAATCATGG - Intronic
1087478847 11:98673824-98673846 CTTTGACCAAATCTGAAAGATGG - Intergenic
1087779474 11:102287400-102287422 CTGTCAGCAAACATCAAAAATGG + Intergenic
1087989068 11:104725045-104725067 CTTTCACAAAGCAGCAAACAAGG - Intergenic
1088119165 11:106347764-106347786 ATTACTTCAAACATGAAACAAGG + Intergenic
1088129450 11:106470021-106470043 CTTTCAACAAACATGAAAAATGG + Intergenic
1088163082 11:106897693-106897715 CTTTCACAAAAAATGCAAAATGG + Intronic
1088953316 11:114591759-114591781 CTTTTAGCAAACATCATACAGGG - Intronic
1092125269 12:6071022-6071044 CTTTCAGCAAACAGGTAATAAGG + Intronic
1096571678 12:52526940-52526962 CTGGCACAAAACGTGAAACAAGG + Intergenic
1096966745 12:55634090-55634112 CTTACAGCAAACATTAAAAAAGG + Intergenic
1099115015 12:78613075-78613097 CTTGCACCAAACAGGACACATGG + Intergenic
1099570326 12:84309721-84309743 CTCTAACCAAACAAGATACAGGG + Intergenic
1101040980 12:100755281-100755303 ATTTCACCAAGCAAGAAAGAAGG - Intronic
1101132216 12:101700505-101700527 CTTTCACCAAACAAGCAATGTGG - Intronic
1102082154 12:110107149-110107171 CTTACAAAAAACAAGAAACAAGG + Intergenic
1102364357 12:112319041-112319063 CTTTCACCAAACTTGGCACCAGG - Intronic
1104654305 12:130561711-130561733 CATTCACTAAACATGATAAAAGG + Intronic
1106965299 13:35057370-35057392 CTTACACAAAACCAGAAACAGGG - Intronic
1107651183 13:42546865-42546887 ATTTCACCAACAATGTAACATGG - Intergenic
1108794727 13:54017698-54017720 CATTCACCACACACAAAACAAGG + Intergenic
1109321890 13:60820562-60820584 TTTTACTCAAACATGAAACATGG - Intergenic
1109991677 13:70066804-70066826 CTTTCATCAAAGGTAAAACATGG - Intronic
1110589658 13:77240872-77240894 GTTTTACCAAACATGAAGGAGGG + Intronic
1111265710 13:85809387-85809409 TGTTCACCAAACATGACAAAGGG + Intergenic
1112329329 13:98464899-98464921 CTTTCAGCAGACAGGAAAAAGGG - Intronic
1113279456 13:108773013-108773035 CTTTCACCAAACATCAAATCTGG - Intronic
1113851274 13:113419822-113419844 CTTTCCCCAAACAGGAAGCATGG - Intergenic
1114068917 14:19093125-19093147 CTCTCTCTAAACATGGAACAGGG - Intergenic
1114093344 14:19306880-19306902 CTCTCTCTAAACATGGAACAGGG + Intergenic
1114281800 14:21199126-21199148 ATTTCACCAAAGATGACATATGG + Intergenic
1115256789 14:31411612-31411634 GTTTCTCCATACATGTAACATGG + Intronic
1116343352 14:43754923-43754945 CTTTCGCCAACCATTAAACGTGG - Intergenic
1116816160 14:49585668-49585690 ATTTCACCAAACACAATACACGG + Intronic
1120091543 14:80337901-80337923 CTTTCACCACACCTGGCACAGGG + Intronic
1121485631 14:94312446-94312468 CATGCACCAAGCATTAAACAAGG + Intronic
1123045805 14:105513518-105513540 ATTTCACCAAACAGGATACATGG - Intergenic
1123537990 15:21258768-21258790 CTTACACAAAACCAGAAACAGGG + Intergenic
1125114850 15:36078521-36078543 CTTTCACCAAATATTACAAATGG + Intergenic
1125734328 15:41913082-41913104 CTTTCCCCACACATCAAACACGG + Intronic
1126396318 15:48222022-48222044 CAGTTGCCAAACATGAAACATGG - Intronic
1127059661 15:55169232-55169254 ATTTCACCAGACATGAAAAGTGG - Intergenic
1130179130 15:81607292-81607314 CCTTCACCAGACAAGAAATAAGG - Intergenic
1131502430 15:92982077-92982099 CTTTCCTCAAACTAGAAACATGG - Intronic
1131978583 15:97972166-97972188 CTATCACTAAATATGAAACTGGG + Exonic
1133664022 16:7947513-7947535 CTGTTTCCAATCATGAAACATGG + Intergenic
1133879425 16:9766468-9766490 CCTTCACCAACCATGAAGCCTGG - Intronic
1135947533 16:26877964-26877986 TTTTCACCACATATGAACCATGG - Intergenic
1138863985 16:60794322-60794344 CTTCCAGCATCCATGAAACAGGG - Intergenic
1138995141 16:62442145-62442167 CTTACACCAAAATTGAAAAAAGG + Intergenic
1140721347 16:77775177-77775199 CATTCAACAACCACGAAACAAGG - Intergenic
1141753388 16:85974935-85974957 GTTTCTCCATCCATGAAACAGGG + Intergenic
1141944750 16:87302097-87302119 GTTCCTCAAAACATGAAACATGG + Intronic
1142112126 16:88338558-88338580 CTGTCACCAAGGAAGAAACACGG + Intergenic
1144150394 17:12437606-12437628 CATTCTTCAAAAATGAAACAAGG - Intergenic
1145976177 17:28985720-28985742 CTGCCACCCAACATGGAACATGG - Intronic
1145992019 17:29085082-29085104 CTTTCTCCAAACAAGAAACTGGG + Intronic
1146523561 17:33546724-33546746 CTTCCACAAAACATGAACCAAGG - Intronic
1148544234 17:48504654-48504676 CTTACAAGAAACTTGAAACACGG - Intergenic
1149261772 17:54887892-54887914 CTTCCACCATACAAGAAAAAAGG - Intergenic
1150984570 17:70181362-70181384 CTCTCACCAAACATTAAATGAGG - Intergenic
1151160965 17:72165586-72165608 ATGTCACCAAGCATGAAGCAGGG + Intergenic
1151299679 17:73214805-73214827 CTTTTACCAAAAGAGAAACAAGG + Intronic
1152508201 17:80767029-80767051 CTTTCATCAGAAATGAAAGAGGG + Intronic
1153367893 18:4279196-4279218 GTTTCTTCTAACATGAAACAGGG + Intronic
1157009239 18:43627014-43627036 ATTTCAGCAAACAGGAAAAAAGG - Intergenic
1157642303 18:49229476-49229498 ATTTCACCAAAGAAGATACATGG + Intronic
1159156063 18:64584280-64584302 ATTTCAACAAACATGAAAGCTGG - Intergenic
1159411056 18:68074673-68074695 CTCCCACAAAACATTAAACAAGG + Intergenic
1161498477 19:4600068-4600090 CTATCACCAAAAAAGAAAAAAGG - Intergenic
1165254697 19:34568728-34568750 ATTTTACCAAACATTAAAGATGG + Intergenic
1165652072 19:37500249-37500271 CTTGCACCACTCATGAAACTAGG + Intergenic
1166424870 19:42668780-42668802 CTATCACCAACCTAGAAACATGG + Intronic
1167176737 19:47869680-47869702 ATTTCACCAAAGAGGACACAGGG - Intergenic
926188522 2:10709846-10709868 CTTCCACCAAACAGGATACCTGG + Intergenic
926235603 2:11041125-11041147 CTTGCAGGAAACATGAAAAAGGG + Intergenic
926595012 2:14780625-14780647 CTTTCATCAAACATTCACCAGGG + Intergenic
927491453 2:23523908-23523930 CTTTTACCAAAGAGGAAAGAGGG + Intronic
927572180 2:24169380-24169402 CTTTCACCAATCAAGGATCAGGG - Exonic
928001063 2:27523442-27523464 CTTTCACCCACCCAGAAACATGG - Exonic
929506386 2:42531334-42531356 CTTTGACCATGCATGAAAAAGGG - Intronic
931198101 2:60072349-60072371 CTTTCAACAAACATCCATCAAGG - Intergenic
932194712 2:69773474-69773496 CATTCACATGACATGAAACAGGG + Intronic
933279277 2:80314803-80314825 CCTTCCTCAAACATGGAACAAGG + Intronic
935042605 2:99447674-99447696 CTTTCACAAATGAGGAAACAAGG + Intronic
936838409 2:116738033-116738055 CTTACACAAAACATGTAGCAAGG - Intergenic
937871146 2:126787283-126787305 CTTCCCCCAAGTATGAAACAGGG - Intergenic
938488067 2:131735195-131735217 CTTACACGAAACCAGAAACAGGG - Intronic
938606976 2:132904441-132904463 CTTGCAGCAAACATGAGAAATGG - Intronic
938607139 2:132906726-132906748 CTGCCAGCAAACATAAAACATGG + Intronic
939052746 2:137328489-137328511 TTTTCTCAAAACATGAATCAAGG + Intronic
940126332 2:150329789-150329811 TTTTCACCAAGCCTGAAACATGG - Intergenic
940343411 2:152604475-152604497 CCTCAACCAAACATGAATCACGG + Intronic
943625886 2:190198900-190198922 TATTGACCAAACATCAAACAAGG + Intronic
944371743 2:198992136-198992158 TTTTCACCAAAAATAAAAGAAGG + Intergenic
1170068111 20:12337277-12337299 ATATCCCCAAACTTGAAACAAGG - Intergenic
1170153520 20:13249366-13249388 CTGCCGCCAGACATGAAACACGG + Intronic
1170401697 20:15992297-15992319 ATTTCTCCTAACATGAAAAATGG - Intronic
1170714487 20:18820048-18820070 CATTCTCCAAACAAGAAACAGGG + Intronic
1170817579 20:19727839-19727861 GTATCACCAATCAAGAAACATGG + Intergenic
1173182639 20:40816307-40816329 CTTGCACAGAACATGGAACACGG - Intergenic
1173406115 20:42766662-42766684 ATTTCACCACACAGGCAACAGGG + Intronic
1175233068 20:57487610-57487632 CTTCCACTAAACTGGAAACAAGG + Intergenic
1175306097 20:57976582-57976604 ATTGCAACAAACATGAAAAAGGG + Intergenic
1177559918 21:22737283-22737305 CTTCCGCCAAACATGTAACTGGG + Intergenic
1178599395 21:33983104-33983126 CTCTGACCAAACAGGAAAGATGG - Intergenic
1180487389 22:15815685-15815707 CTCTCTCTAAACATGGAACAGGG - Intergenic
1181751746 22:24993705-24993727 CTATCACCAAACATGGAGTATGG + Intronic
949470667 3:4392935-4392957 CTTTCACCTTTCATGAACCAAGG + Intronic
950173279 3:10853792-10853814 CATCCATCAAACATGAATCAAGG - Intronic
951033129 3:17904899-17904921 CCTTCACCAAACCTAAAACAAGG - Intronic
953428647 3:42818289-42818311 CATTCACCAAACATGAAAGCTGG + Intronic
956002134 3:64740875-64740897 CTTTAAAAAAAAATGAAACAAGG + Intergenic
957482232 3:80813247-80813269 CTCTCACCAGACAGTAAACACGG - Intergenic
958145027 3:89613049-89613071 CATTCAGCAAACATGAAACTAGG - Intergenic
959643095 3:108663823-108663845 CATTCACCAAACATTTATCAAGG + Intronic
960196846 3:114778997-114779019 ATTTCAATAAACATGAAAAATGG + Intronic
960657894 3:120026230-120026252 CTTTCCCCAAATATCAAGCAAGG + Intronic
960998668 3:123357574-123357596 CTTTCACTAAACACAAAACCAGG + Intronic
961350382 3:126297177-126297199 CTTTAAGCAAATATAAAACAGGG - Intergenic
961366074 3:126400410-126400432 CTTTCACCAACAATGTAAAAGGG - Intronic
961396976 3:126600506-126600528 CTGTCAGCAAACATCAAAAATGG + Intronic
962722898 3:138192859-138192881 ATTTCACCAAAGAGAAAACATGG - Intronic
964496736 3:157299256-157299278 CATTCTCAAAAAATGAAACATGG + Intronic
966118223 3:176490521-176490543 CGTTCACCTCACCTGAAACATGG - Intergenic
966283356 3:178262383-178262405 CTTTCAACAAACATGTAACCAGG - Intergenic
969244889 4:5925588-5925610 CTTTCACCAAGCATAACACTGGG + Intronic
970532042 4:16994764-16994786 CTTTCAACAAACATCTAGCAAGG - Intergenic
971083791 4:23246524-23246546 CTTTCACAATAGCTGAAACAGGG - Intergenic
971908971 4:32769439-32769461 ATTTCCCTAAACATGTAACAAGG - Intergenic
972329410 4:38050642-38050664 CTCTCACCTAATATGAATCAAGG + Intronic
976534975 4:86202247-86202269 CTTGCAGCATACATTAAACAGGG + Intronic
977131459 4:93244862-93244884 CTTTAAGAAAACATAAAACAGGG - Intronic
977431139 4:96931319-96931341 CATTAATCACACATGAAACAAGG - Intergenic
979396128 4:120191737-120191759 CCATCACCAAAGATGAAACAGGG - Intergenic
979557637 4:122067662-122067684 TTCTTACCAAACATAAAACAAGG - Intergenic
979888043 4:126056851-126056873 CTTTCACCATCCATGCAAGATGG - Intergenic
981636416 4:146885955-146885977 AATTCACCAAAGATGAAATATGG - Intronic
983300254 4:165916035-165916057 CTTTCACCAAACATGAAACAAGG - Intronic
985522199 5:379624-379646 CATTCACCAAAGATGACACACGG - Intronic
987287482 5:16471605-16471627 GTTTCCCCAAACATTAAATAGGG - Intergenic
987357530 5:17077669-17077691 CTGTCACCAAAAATGATAAAAGG + Intronic
989409312 5:41099662-41099684 ATTTCACAAACAATGAAACAAGG + Intergenic
989443793 5:41504730-41504752 CTTTCCCAAAACAGGAAAGAAGG + Intronic
990260437 5:54016077-54016099 GTTCCACAAAACATGAGACAAGG - Intronic
990879035 5:60519512-60519534 CTTTCAACAAGCATGAAATCTGG + Intronic
991255583 5:64610366-64610388 CCTTCACTAAACTTGTAACATGG + Exonic
991534432 5:67651076-67651098 TTAAGACCAAACATGAAACAAGG - Intergenic
992883184 5:81130877-81130899 CTTGCTCCTAACAGGAAACAAGG + Intronic
993674579 5:90801555-90801577 CATTCACTGAACATGAATCATGG - Intronic
994465967 5:100131601-100131623 ATTTTACCAAACATGCAAAAGGG - Intergenic
995715382 5:115077536-115077558 CTATCAGCAAACATCATACAAGG + Intergenic
996339887 5:122424971-122424993 CATTCAACAAACATAGAACAGGG + Intronic
998642164 5:144023126-144023148 CTTTCACCAGACAACAAACCTGG + Intergenic
998946411 5:147344598-147344620 TTTTCCCCCAACAAGAAACAGGG - Intronic
999364135 5:151010574-151010596 CTTAAATCAAAGATGAAACAAGG - Intergenic
1000400788 5:160824920-160824942 ATTTTACCAAACAGGAAACCAGG - Intronic
1003840127 6:10111505-10111527 TTTTCTCCAAACATCACACAGGG - Intronic
1004573164 6:16867715-16867737 CTTTCATCAAAAATGAATGATGG + Intergenic
1004783479 6:18938997-18939019 ATTTCTCCAAACATCAAATAAGG - Intergenic
1004789892 6:19013429-19013451 CTTTCTCCAACCCTTAAACATGG + Intergenic
1007066233 6:38992734-38992756 CTCTCAAGAAAGATGAAACAGGG + Intronic
1007964832 6:45994660-45994682 CTTTCACCACTCATGAGACATGG - Intronic
1008173094 6:48233886-48233908 CTGTCACCAAACAGCAAAAATGG - Intergenic
1008550682 6:52627096-52627118 CTTCCAGCAAAAATGAAGCAGGG - Intergenic
1008662377 6:53681640-53681662 GTTTCACCAACAATGAGACAAGG + Intergenic
1008862845 6:56171002-56171024 CTTTCACCAAAAAAGATAAAAGG - Exonic
1009742936 6:67771018-67771040 CTTTCCCTAGAGATGAAACAGGG - Intergenic
1012866659 6:104626020-104626042 TTTTCACCAAAAATGACACATGG + Intergenic
1014572282 6:123024561-123024583 CTTCCACCTGACATGAAATAGGG + Intronic
1017153346 6:151301044-151301066 CTGTTACCAAACAAGAAAGAAGG - Intronic
1018776820 6:167024766-167024788 CTTCCTCCTAACAAGAAACAAGG - Exonic
1019029939 6:169001205-169001227 CATTCAGCAAACAGGACACAGGG + Intergenic
1019222851 6:170488090-170488112 CTGTCCCCAACCATCAAACATGG - Intergenic
1020975391 7:14999705-14999727 CTTTCACCAGGCATGGAAGAAGG + Intergenic
1023475181 7:40569928-40569950 CTTTCACCAATCATGAAGTGTGG + Intronic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1024696372 7:51860371-51860393 CATTCACTAAGCATGAAACAGGG + Intergenic
1026545079 7:71315420-71315442 CTTCCTCCAAAGGTGAAACATGG - Intronic
1027931728 7:84545681-84545703 CTTTCAACAAAATTGAAAGATGG - Intergenic
1030880413 7:114871106-114871128 CTTTTACCAAATACCAAACATGG + Intergenic
1037251283 8:16897498-16897520 CTTTAACCCCAGATGAAACATGG - Intergenic
1038035780 8:23685022-23685044 ATTTCACCAAAGAGGAAATATGG - Intergenic
1041029337 8:53719737-53719759 CTTTTACAAAAGAGGAAACAGGG + Intronic
1041592057 8:59599260-59599282 CTTTCCTTAACCATGAAACAAGG + Intergenic
1042584993 8:70326540-70326562 CTTTCATAAAATATAAAACAAGG + Intronic
1043122730 8:76349132-76349154 CTTTCTCAAAACCTGAAAAATGG - Intergenic
1043688447 8:83118197-83118219 ATTTCATCAATCATCAAACAAGG - Intergenic
1044317322 8:90764957-90764979 CAGTCTCCAAGCATGAAACAAGG - Intronic
1045947029 8:107807994-107808016 CTTTCATAAAAGCTGAAACAAGG + Intergenic
1046418869 8:113952660-113952682 CTTTCAGCAAACTTGAATAAAGG - Intergenic
1047204687 8:122793716-122793738 CTTTGACCAAACTGGAAAGAAGG - Intronic
1048035615 8:130674566-130674588 CTTTCAACAAACTGGAAACCTGG - Intergenic
1048896418 8:138996479-138996501 CATTTGCCAAACATGAGACAAGG - Intergenic
1049563985 8:143328031-143328053 CTGTGACAAAACATGAAACGTGG + Intronic
1051094056 9:13444848-13444870 CTTACTCTAAACATCAAACAAGG - Intergenic
1051824269 9:21201615-21201637 TTTTCAACAAACTTGAAAAAAGG - Exonic
1052120333 9:24707279-24707301 AATTCACAGAACATGAAACATGG + Intergenic
1055249618 9:74287278-74287300 CATTCAACAAATATGAAATATGG - Intergenic
1055906541 9:81301068-81301090 CTTTCACCAAACAGTTAACCAGG + Intergenic
1056540324 9:87565432-87565454 CTTTCCCCAACCATAAAATAGGG - Intronic
1057139860 9:92719826-92719848 CTTTCCCCAACCATGCTACAGGG + Intronic
1059094288 9:111395866-111395888 CTTTGAACACACATGAAGCAAGG - Intronic
1059805868 9:117799677-117799699 CCTTCACCAAACTTGAAGCTAGG - Intergenic
1060550596 9:124483127-124483149 CTGCCACCAACCATGCAACATGG + Intronic
1185678263 X:1866436-1866458 CTTTCACCAAACATGTTATTGGG + Intergenic
1186039816 X:5463477-5463499 GTTTAACCAAACATGGATCACGG - Intergenic
1187078317 X:15958831-15958853 CTTCCACCAAAGAAGATACATGG - Intergenic
1191611537 X:63120262-63120284 CATCCAACAAACATGAAAAATGG + Intergenic
1194190690 X:90833694-90833716 CATTTACCAGACATAAAACATGG - Intergenic
1195512518 X:105733893-105733915 CTTTCAACAAAAAAGTAACAAGG - Intronic
1196553488 X:117059057-117059079 CATTCAGCAAACACAAAACATGG - Intergenic
1197004245 X:121476856-121476878 CTTTTAACAAACTTGAAGCAGGG - Intergenic
1197866419 X:131023618-131023640 GGTTACCCAAACATGAAACATGG + Intergenic
1198220181 X:134591932-134591954 ATTTAACCAAAGAGGAAACATGG - Intronic
1198261384 X:134968013-134968035 GTTTCACAAAAGAAGAAACATGG - Intergenic
1199584816 X:149403811-149403833 CTTTCACCAGACATGAGGCTTGG + Intergenic
1199634274 X:149801146-149801168 CTTTCACCAAAAATGTTACAAGG - Intergenic
1200537347 Y:4416115-4416137 CATTTACCAGACATAAAACATGG - Intergenic
1200958014 Y:8970929-8970951 CTTTCCCCCATCATGAAAAAAGG + Intergenic
1201469913 Y:14321789-14321811 GTTTGACCAAACATGAGACCTGG - Intergenic
1201561887 Y:15326459-15326481 CTTTCAACAAACCTGATAAAGGG - Intergenic
1202588476 Y:26456937-26456959 CTTTTACCTTACATGTAACAGGG + Intergenic