ID: 983303115

View in Genome Browser
Species Human (GRCh38)
Location 4:165952864-165952886
Sequence CCCATTCTTGCTCTTTAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 116}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983303115_983303119 3 Left 983303115 4:165952864-165952886 CCCCACTAAAGAGCAAGAATGGG 0: 1
1: 0
2: 2
3: 10
4: 116
Right 983303119 4:165952890-165952912 TAAAAGAAACAGAAAACTTGAGG 0: 1
1: 0
2: 14
3: 149
4: 1478

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983303115 Original CRISPR CCCATTCTTGCTCTTTAGTG GGG (reversed) Intronic
902063689 1:13666300-13666322 CCCATTCCTGCTCTTCATTATGG - Intergenic
903593721 1:24478256-24478278 CACACTATTGCTCTCTAGTGTGG - Intergenic
904120155 1:28192970-28192992 TCCTGTCATGCTCTTTAGTGCGG + Intronic
911820235 1:102410000-102410022 CCTAGTCTTGCTCTATAATGGGG - Intergenic
912940948 1:114044219-114044241 CCCACTCTTGCTTTGTATTGAGG + Intergenic
918269046 1:182878180-182878202 CCCATTCTTGACCTTTAGTAAGG + Intronic
920825059 1:209417288-209417310 CTCATTTTTGCTCTTTAGTTGGG - Intergenic
920955800 1:210619277-210619299 CCCATTCTTCCTCTTTCTTCTGG + Intronic
921936022 1:220797894-220797916 CCCATTCTTGATCCTTTCTGAGG + Exonic
924083068 1:240419871-240419893 CCCACTCTTGCCCTTTTCTGTGG + Intronic
1065611109 10:27471436-27471458 CATATTCTTTCTCTTTTGTGGGG + Intergenic
1067968537 10:50942508-50942530 TCAATTTTTTCTCTTTAGTGGGG + Intergenic
1070774150 10:79100112-79100134 CCCAGTCTTGTTCCCTAGTGAGG - Intronic
1074520864 10:114222655-114222677 CCAATTCTTGGTCTATAGGGTGG - Exonic
1078722367 11:13896892-13896914 CCCTCTCTGGCTCTTCAGTGGGG + Intergenic
1080309083 11:30868549-30868571 CCCATACCTGCTCTATAGAGAGG + Intronic
1085287325 11:75372106-75372128 CCCCTTCCTTCTCTTTATTGGGG + Intergenic
1086904878 11:92406909-92406931 CCCCTTCATGCTCTGTAGAGTGG - Intronic
1087605039 11:100366804-100366826 CCCATTCTTGGTCTTGGGTCTGG + Intergenic
1089528476 11:119111980-119112002 CCTACTCTTGCTCTAAAGTGTGG - Intronic
1089849641 11:121485054-121485076 CCCATGCTTGTTCTTAAGGGCGG + Intronic
1090920471 11:131201929-131201951 CACATTCCTGCTCCTGAGTGGGG + Intergenic
1094166320 12:27447323-27447345 CCCATTCTGCATCTTTACTGGGG + Intergenic
1094329141 12:29273369-29273391 CCCATCCTTCCTCGTTGGTGGGG - Intronic
1098926171 12:76351182-76351204 CCCATTCTTGCTCTCTGCTCAGG - Intergenic
1100713723 12:97283904-97283926 ACCATTCATGTTCTCTAGTGAGG + Intergenic
1102140447 12:110610661-110610683 CTCTGTCTTGCTCTTTGGTGTGG - Intergenic
1102242341 12:111332432-111332454 CCCAATCTAGCTTTTTAATGTGG + Intronic
1102382556 12:112479875-112479897 CTCATTCTTCCTCTTTACTTTGG + Intronic
1106696979 13:32185192-32185214 CCCATTCGTGTTCTTTATTACGG + Intronic
1106788951 13:33135236-33135258 CCCAAACTTGCTCTTTAATGAGG + Intronic
1106960436 13:34991266-34991288 CCCATTCTTGCACTGCTGTGAGG + Intronic
1113924821 13:113935559-113935581 AACATTCTTCCTCTTTAATGAGG + Intergenic
1114903072 14:27090050-27090072 CATATTCTTGCTCTTTACTGGGG - Intergenic
1116051382 14:39807599-39807621 CAGATTCTGGCTCTTTAGTCTGG - Intergenic
1119331487 14:73797722-73797744 CTCAGTCTTGCTCTTTAATTTGG - Intergenic
1123145022 14:106120835-106120857 CTCTTTCTTACTCTCTAGTGCGG + Intergenic
1128241945 15:66107328-66107350 CTAATGCTTGCTCTTCAGTGAGG - Intronic
1128741389 15:70086202-70086224 TCCATTCTAGCTCTCTGGTGGGG - Intronic
1129297638 15:74608701-74608723 CACATTCTGGCTCTTTTATGGGG - Intronic
1130435841 15:83898596-83898618 CCCATTTCTGCTCTTTCATGTGG - Intronic
1131033916 15:89208653-89208675 CTCTTTCTTGCTTTTCAGTGAGG - Intergenic
1135096060 16:19565727-19565749 CCCTTCCTTCCTCCTTAGTGAGG + Intronic
1135724121 16:24841368-24841390 CTTATTCTTGCTCTTTAGTGTGG - Intergenic
1137962502 16:52897184-52897206 CCCTTTCTTGTTCTATAGTTTGG - Intergenic
1139708738 16:68760559-68760581 CCCATTCTTTCTCTTTAATCTGG + Intronic
1142308096 16:89296864-89296886 CCCATTCCTGCCCTCTGGTGGGG - Intronic
1144390372 17:14787955-14787977 CCCATTCTTTCTCATGAATGGGG + Intergenic
1144992478 17:19243179-19243201 CCCATTGTTTCTCATTAGGGAGG + Intronic
1147623745 17:41885767-41885789 CCCATTTTCCCTCTTTAGTAGGG - Intronic
1148649425 17:49238953-49238975 CCCATTATTGCTGCTAAGTGAGG - Intergenic
1156670899 18:39468152-39468174 CTCTTTCTGTCTCTTTAGTGGGG - Intergenic
1159702497 18:71646463-71646485 CGCCCTCTTGCTCTTTTGTGAGG + Intergenic
1164320425 19:24139310-24139332 CCCATTCTTTTTCTTTTTTGGGG - Intergenic
1165508857 19:36254260-36254282 CCCACTCTGGCTCTGTAGAGTGG + Intergenic
1168331796 19:55574576-55574598 CCCTTTCTTGCTGTTTCTTGTGG + Intergenic
926084107 2:10010268-10010290 CCCATGCCTGCTCTCCAGTGTGG - Intergenic
926177951 2:10613547-10613569 TACATTCTTACTATTTAGTGTGG - Intronic
928762544 2:34601827-34601849 CCCATTCTTCCTCATCAGTCAGG - Intergenic
932521256 2:72415682-72415704 CCTATTCTTCCTCATTAATGAGG - Intronic
933120427 2:78529550-78529572 CCCATTTTTTCTCTTTTGCGTGG - Intergenic
933921095 2:87046963-87046985 CTCATTTTTGCTTTTTAATGAGG - Intergenic
933930541 2:87146832-87146854 CTCATTTTTGCTTTTTAATGAGG + Intergenic
934001871 2:87722622-87722644 CTCATTTTTGCTTTTTAATGAGG + Intergenic
936362589 2:111818615-111818637 CTCATTTTTGCTTTTTAATGAGG - Intronic
938411764 2:131070796-131070818 CCCATTTTTTCCCTTTAGAGTGG - Intronic
940180926 2:150931968-150931990 CCCCTTCTTACTCCCTAGTGAGG + Intergenic
942105696 2:172631146-172631168 CCCTTTCTTGCTGTTTTGTGGGG + Intergenic
944508672 2:200442544-200442566 CTCTGTCTTACTCTTTAGTGTGG + Intronic
948921159 2:241066534-241066556 CCCATTCTTGCTCCTGTGTCTGG - Intronic
1169353747 20:4891126-4891148 CCCATTCTTCCTTTTTAGGCAGG - Intronic
1174407535 20:50311900-50311922 CACATTCCTGCGCTTTCGTGAGG - Intergenic
1181922023 22:26328019-26328041 CCCTTCCTTGCTATTGAGTGGGG + Intronic
1184200487 22:42965410-42965432 CGCCTTCTTCCTCTTTATTGAGG - Intronic
950276062 3:11661930-11661952 TCCTTTATTGCTGTTTAGTGCGG - Intronic
950329043 3:12141571-12141593 CACATTCTCGCTCTGTAGAGAGG + Intronic
950416674 3:12872889-12872911 CCCGTTCCTGCTCTTTGTTGGGG - Intergenic
955993036 3:64649005-64649027 CCCATTCTGTCTCTTTGGGGTGG - Intronic
956528204 3:70187798-70187820 CCTATGCTTGCTCTGCAGTGTGG + Intergenic
957923244 3:86773721-86773743 CACATTCATGCTCTTCTGTGTGG - Intergenic
963285017 3:143425951-143425973 GCCATTGTGGCTCTTTAGTGTGG - Intronic
971410262 4:26363461-26363483 CCGATTCTTGCTCTGTTGTCCGG + Intronic
974316015 4:60282066-60282088 CCCATTCTCTCTCTTGGGTGTGG + Intergenic
975026205 4:69551203-69551225 CTCATTCTTTCTCATTTGTGTGG - Intergenic
975417975 4:74128184-74128206 CCCATTCTGTCTCTTTACTTTGG + Intronic
978625238 4:110677799-110677821 CCTATTCTAGATATTTAGTGGGG + Intergenic
980459945 4:133096606-133096628 GCTATTCTTGCTTTTTTGTGTGG - Intergenic
981648788 4:147031360-147031382 CCCATTGTTGGTGTTTACTGTGG + Intergenic
983303115 4:165952864-165952886 CCCATTCTTGCTCTTTAGTGGGG - Intronic
984147159 4:176076649-176076671 CTCTTTATTGCTCTTTAATGTGG + Intronic
987161765 5:15152201-15152223 CTGATTCTTCCTCTTTAGTAGGG + Intergenic
988330458 5:29831869-29831891 TTCTTTCTTGCTCTTTAGTAAGG - Intergenic
989956412 5:50366119-50366141 CCCATTCATGTTCTTTCCTGAGG - Intergenic
990483026 5:56229854-56229876 CCCTCTGTTGCTATTTAGTGGGG + Intronic
994327136 5:98461575-98461597 CCCCTCCTTGCCCTTTAATGAGG - Intergenic
998353866 5:141518420-141518442 CCCAGTCTTGGTCTTTATTTAGG - Intronic
1000243642 5:159431402-159431424 GCCATACTAGCTCTTTAATGAGG - Intergenic
1003674953 6:8194503-8194525 CCCATTCTTCCTCTTTAAGCTGG + Intergenic
1005229181 6:23680560-23680582 GCCTATCTTGCTCTTTAATGAGG - Intergenic
1008434855 6:51464090-51464112 CCCATGCATGCTCTTTTATGAGG + Intergenic
1009728492 6:67565880-67565902 CTCATTCTTTCTCTTTTTTGGGG + Intergenic
1010881631 6:81181681-81181703 CCCATTTTTGCTCTTAAGATTGG + Intergenic
1015062612 6:128984934-128984956 CACTTTCTTGCTCTTCCGTGTGG + Intronic
1016318387 6:142815206-142815228 CCAATACTTGCTCTTTGGGGGGG + Intronic
1020049250 7:5071151-5071173 CCCATTTCTGCTTTTTAGAGGGG - Intronic
1022309455 7:29182848-29182870 CCCGTTTTTGCCCTTTTGTGTGG + Intronic
1026057781 7:66999763-66999785 CCCATTCTCTCTCTTTTTTGCGG + Intronic
1028478585 7:91278809-91278831 TACATTTTTGCTCTTTAGTGAGG + Intergenic
1031140773 7:117940780-117940802 TCCCTTCCTGCTCTGTAGTGAGG + Intergenic
1031825318 7:126558202-126558224 GCCATTTTTGCTCTTCACTGTGG - Intronic
1031973054 7:128077538-128077560 CCCAGTCTTGCTCTGTAGCTGGG + Intronic
1032564993 7:132932564-132932586 CCCACTGTTCCCCTTTAGTGAGG + Intronic
1033009652 7:137607106-137607128 CCTTTTCCTGCTCTTTACTGTGG - Intronic
1036211378 8:6843867-6843889 CCCATTCTATCTCTTTAGCAGGG - Intergenic
1039756124 8:40524833-40524855 GACATTCCTGTTCTTTAGTGAGG - Intergenic
1044055441 8:87564234-87564256 AGGATTCTTGCTCTCTAGTGGGG - Intronic
1047026451 8:120829713-120829735 GAAATGCTTGCTCTTTAGTGAGG - Intergenic
1047476763 8:125239950-125239972 CCCCTTCTTGCTCATTGCTGAGG + Intronic
1049141868 8:140962340-140962362 CAAATTCTTGCTGTTTTGTGTGG + Intronic
1050704556 9:8382430-8382452 CCCATTCCAGCTCTTTACTCAGG + Intronic
1053485747 9:38454783-38454805 CCCCTTCTTGCTTTCTAGTATGG + Intergenic
1056998225 9:91483734-91483756 CTCATTCTTGCTCTTGCGGGGGG - Intergenic
1057903035 9:98964213-98964235 CCCATTCTTGGTCTCTAGTTAGG + Intronic
1062559776 9:137136346-137136368 CCCAGTCTAGCTCTTTAGCGGGG + Intergenic
1187069691 X:15875901-15875923 CCCATTCTTATTTTTTATTGTGG + Intergenic
1188777013 X:34232151-34232173 TCCATTCTTGCTCTTTAATGTGG - Intergenic
1189669011 X:43387929-43387951 CCCATGATTGTTCCTTAGTGTGG + Intergenic
1198723965 X:139656491-139656513 TTCATCCTTTCTCTTTAGTGTGG - Intronic
1200072629 X:153536657-153536679 CCCAGTCTCGCTCTATAGAGCGG - Intronic