ID: 983305465

View in Genome Browser
Species Human (GRCh38)
Location 4:165979544-165979566
Sequence CTGGTTACTCTGAGAGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 156}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983305465 Original CRISPR CTGGTTACTCTGAGAGAACA TGG Intronic
900226169 1:1534555-1534577 CTGGTGACCCTGAGAGAGGAGGG + Exonic
900877389 1:5352951-5352973 CTGGCTTCTCTGAGTGAACTGGG - Intergenic
901154656 1:7127386-7127408 CTGGAAACTTTGAGACAACATGG - Intronic
902743580 1:18457812-18457834 CTGGGTAGACTGAGGGAACAAGG + Intergenic
903065163 1:20695616-20695638 CTGGTAAGTCACAGAGAACAGGG + Intronic
906569037 1:46820655-46820677 CTGGCCACTCCGAGTGAACAGGG - Intergenic
909054734 1:70807364-70807386 CTGGGTTCCCTGAGAGCACAGGG + Intergenic
912055014 1:105584817-105584839 CTGGTTACAATGAGATAACGGGG - Intergenic
913266612 1:117051377-117051399 CCGGATACTGAGAGAGAACAAGG + Intergenic
913345631 1:117806753-117806775 CTAGTTATTCTGAGATAAAAGGG - Intergenic
913679774 1:121178716-121178738 CTGTTAGCTCTGTGAGAACAAGG - Intronic
915047514 1:153030780-153030802 CTGGTTATTCTGGGAGGCCAAGG - Intergenic
915993736 1:160543642-160543664 CCAGTTAGACTGAGAGAACAGGG - Intronic
918598847 1:186328032-186328054 CTGAGTACTCTGAGAGGCCAAGG - Intronic
919483458 1:198117875-198117897 ATGGTTCCTCTGAGAGAATCAGG - Intergenic
919658711 1:200222218-200222240 CTGGATACTCCATGAGAACAGGG + Intergenic
921952601 1:220946120-220946142 ATAATTACTCTGAGATAACAGGG - Intergenic
922195436 1:223355628-223355650 TTTGTTACTCTGAGAAAAAAAGG + Intronic
924013901 1:239698682-239698704 CTGGATACTCTGGGTGACCATGG - Intronic
1067655498 10:48188543-48188565 CTGGGGACTCTCAGAGGACAGGG - Intronic
1068433681 10:56963757-56963779 CAGGTTTCTCCGAGAAAACAAGG + Intergenic
1068905705 10:62319388-62319410 CTGTTTACTCGGAGAACACAAGG + Intergenic
1074900489 10:117812387-117812409 CTGGTTACTCAGAGAAATCCAGG - Intergenic
1075703854 10:124486815-124486837 CTGGTCAGACTGAGAGAGCAGGG + Intronic
1081063248 11:38505694-38505716 CTGGTGGCTATGAGAGAAAATGG + Intergenic
1081192352 11:40119489-40119511 CTGTGGACTCTGTGAGAACAGGG + Intronic
1081604241 11:44517433-44517455 CTGGTGACTCTCAGAGAAGTGGG - Intergenic
1083095417 11:60245674-60245696 CGGGTGACTGTGAGAGAAGAGGG - Intergenic
1084125602 11:67096994-67097016 TTGGATGCTCTGAGAGAACTAGG - Intergenic
1087349179 11:97009525-97009547 CTGGTTTCTCTTAGAAAACTTGG - Intergenic
1089440668 11:118514105-118514127 CTGGAGACTCTGAGGGTACAAGG - Intronic
1090793626 11:130114662-130114684 CTGTTTTCTCTGAGACACCATGG + Intronic
1091662554 12:2395467-2395489 CTGGTCACTTTGAGAGGCCAAGG - Intronic
1092319008 12:7451539-7451561 CTGTTTACTTTGAGGAAACAAGG - Intronic
1092910724 12:13142760-13142782 CTTGTTGCTCTGGAAGAACATGG + Intergenic
1093274683 12:17109639-17109661 CTTGTTAATCTGAGAGAAACTGG + Intergenic
1093416842 12:18929830-18929852 CTGGATACCCTGATAGGACAGGG + Intergenic
1093428158 12:19052683-19052705 CTGGTTACTCAGATAGCACATGG + Intergenic
1095772027 12:45970371-45970393 CTGGTTACACAGAAAGAAGAGGG + Intronic
1096531759 12:52247017-52247039 CCGGGTACTCTGAGAGGATATGG + Intronic
1097093187 12:56523972-56523994 CTGGGTAACCTGAGAGAACTAGG - Intronic
1097288532 12:57895752-57895774 CTGGTTGCTCTGAGAAGCCATGG + Intergenic
1098884371 12:75945405-75945427 CAGGTTATTCTGAGAGCTCAAGG + Intergenic
1099887801 12:88553292-88553314 CTGGAAACTCTGAGGGAATAGGG + Intronic
1103916029 12:124376161-124376183 GTGGCTGCTCTGAGAGATCAGGG - Intronic
1103921976 12:124403925-124403947 CTGGCTCCTCTTACAGAACATGG - Intronic
1104947688 12:132423919-132423941 CTGGATCCACAGAGAGAACATGG + Intergenic
1112324613 13:98435209-98435231 CCTGTTACTCGGAAAGAACAAGG - Intronic
1113017902 13:105849084-105849106 GTGGTAACTCTGACAGAACGTGG - Intergenic
1114856073 14:26445766-26445788 CTGCTGACTCTGAGACAGCATGG + Intronic
1118816800 14:69319667-69319689 CTGGAGACTCTGGGAGCACAGGG + Intronic
1121698425 14:95932096-95932118 CAGCTTCCTCTGAGATAACAGGG + Intergenic
1127719485 15:61685838-61685860 ATGGCTACACAGAGAGAACAGGG - Intergenic
1128173675 15:65534351-65534373 CTAGTGACTATGAGAGAACACGG + Intronic
1130039761 15:80396307-80396329 CTGGTTACTCTGATACAACAGGG - Intronic
1130136210 15:81183987-81184009 ATGGTTGCTGTGAGAGAAGAGGG - Intronic
1136420319 16:30128202-30128224 CTGGCTACTCTGAGAGGAGGGGG - Intergenic
1140321354 16:73954759-73954781 CTGCCTACTCTAAGAGAGCAAGG - Intergenic
1142826207 17:2512906-2512928 CTGGTTCCGCTGAAAGAACTGGG + Intergenic
1147259546 17:39200819-39200841 CTTGTTACTGTGATAAAACAGGG + Intronic
1149542108 17:57475239-57475261 CTGGGACCTCTGTGAGAACAGGG - Intronic
1151014966 17:70543495-70543517 CTTGTTACTCTGGGATATCATGG + Intergenic
1152292077 17:79445716-79445738 CTTGTGACTCTGGGAGCACATGG - Intronic
1156296606 18:35797471-35797493 CTGGAAACTCTTAGAGGACAGGG + Intergenic
1156562276 18:38138875-38138897 CTGATTGCTCTGAGTAAACAGGG + Intergenic
1159360787 18:67399966-67399988 GTGGTTCCTTTGTGAGAACAGGG + Intergenic
1162192343 19:8956832-8956854 CTGGCTCCTCTGAGATTACAAGG - Exonic
1164336586 19:24328163-24328185 ATGGTTACTCTGTGAGATGAAGG - Intergenic
1165318045 19:35068645-35068667 CTGGGGACTCTGAGAGAACATGG + Intergenic
1165878122 19:39024185-39024207 CTGGTTTCTCTGAAAAAACGAGG - Exonic
1166086927 19:40482451-40482473 CTGCATACACTGAGAGAACTGGG + Intronic
1167586733 19:50379640-50379662 CTGGTGTGGCTGAGAGAACAGGG + Intronic
927413336 2:22851435-22851457 ATCGTTATTCTGAGAGAAGAAGG - Intergenic
934954492 2:98606239-98606261 CTGGGGACTCTGAAAGACCAAGG - Intronic
938478090 2:131634331-131634353 CTGGTTACTCTGAGCCAGCTTGG + Intergenic
940146054 2:150545020-150545042 CTGGTTTCTCTCAGACCACAGGG - Intergenic
946081658 2:217125319-217125341 CTGTTTACTCAGAGAGAGGAAGG + Intergenic
946296009 2:218783905-218783927 CTGGTTCCTCTGAGGGGCCATGG + Intronic
947806673 2:232973473-232973495 CTGGTTTGACTGACAGAACATGG + Intronic
948573716 2:238936313-238936335 CTTGTTACTGTGTGAGAGCAGGG + Intergenic
948873059 2:240813263-240813285 CTGGTTGCTCTGAGACCCCATGG + Intronic
1169310173 20:4531288-4531310 CTGGTAACTCTGGGAGATGATGG + Intergenic
1170994718 20:21341571-21341593 CTGGGTATTCTGAGAGCTCATGG - Intronic
1175995502 20:62810500-62810522 CTGTTTCCTCTGCGAGAACCAGG + Exonic
1178624382 21:34202960-34202982 CTGGATCCTCTGAAATAACAGGG - Intergenic
1178693019 21:34765543-34765565 CTGGTAGCTCTTAGAGAATAGGG - Intergenic
1182200375 22:28562423-28562445 CTGGTATTTCTGAGAGGACAAGG + Intronic
1182716280 22:32358316-32358338 TTTGTTCCTCTGAGAGACCATGG - Exonic
1182806063 22:33071615-33071637 CTGTTAACTGTGTGAGAACAGGG - Intergenic
949286787 3:2416080-2416102 TTGTTCACTCTGTGAGAACATGG - Intronic
951742532 3:25940234-25940256 CTGGTCACTTTGAGGGAATAAGG + Intergenic
952735010 3:36680777-36680799 CTGGTGAATCTGTGAGAAGAGGG - Intergenic
953042800 3:39269726-39269748 CTGGGGACTCTGAGACAGCAGGG - Intronic
954257436 3:49416486-49416508 GTGGTTATTCAGACAGAACAAGG + Intergenic
954899593 3:54007416-54007438 GTGTTTACTCTGGGAGAACTTGG - Intergenic
956260643 3:67336542-67336564 CTGGATACTCTCAGAGGACCAGG - Intergenic
956868382 3:73391801-73391823 CTGGTTACACTGAGAGCCCTAGG - Intronic
957332938 3:78789669-78789691 CTGGTTAACTTGAGAGAACACGG + Intronic
959401861 3:105912482-105912504 CTTGATAGTCTGAAAGAACATGG + Intergenic
959442009 3:106388605-106388627 CTGGGTATTCAGAGAGACCATGG - Intergenic
960086832 3:113600379-113600401 CTGGTCACTCTGAGAGTGGATGG - Intronic
961009857 3:123428500-123428522 CTGGTGATTCTCAGAGGACAGGG - Intronic
961793410 3:129392700-129392722 CTGGTGACTCAGAGAGGGCATGG + Intergenic
961807407 3:129499318-129499340 CTGGTGACTCAGAGAGGGCATGG + Intronic
963335441 3:143970045-143970067 CTGATTAAGCTGAGAGAACCGGG - Intergenic
964793247 3:160472355-160472377 CTGGTTACTATAAGAGAAGGGGG - Intronic
964894166 3:161574793-161574815 CTGGTTACACAGAGAGGTCAAGG - Intergenic
966478811 3:180381980-180382002 CTTGTTTCTCTCAGATAACAAGG - Intergenic
967744488 3:193039830-193039852 CTCCTTACTCTGAGATAGCAGGG + Intergenic
968779220 4:2566874-2566896 CTGATTACTATGTAAGAACAAGG + Intronic
969449021 4:7262497-7262519 CTGGAAGCTCTGAGAGGACAGGG - Intronic
970495969 4:16626543-16626565 CTGATTTCTCTGTGAGAACCTGG - Intronic
970990135 4:22203590-22203612 CTGTTTTCACTGTGAGAACATGG - Intergenic
972533847 4:39983335-39983357 ATGGTTACCCTTAGAGTACAAGG + Intergenic
974615638 4:64276339-64276361 GTGTTAACTCTGAGAGAACATGG + Intronic
975495129 4:75028742-75028764 GTTGTTACTCTGAGAGAGCTGGG - Intronic
978365336 4:107975242-107975264 CTGGTTCCTCTGAGTGGAAATGG - Intergenic
978374137 4:108057506-108057528 CTGGCTGCTCTAAGAGGACAGGG + Intronic
981650019 4:147046767-147046789 CTGGTAAATTTGAGAGAACAAGG - Intergenic
983305465 4:165979544-165979566 CTGGTTACTCTGAGAGAACATGG + Intronic
989049466 5:37305202-37305224 CTGTTTAATCTGAAAGAAAATGG + Exonic
992201363 5:74387585-74387607 GTGGTTACTGAAAGAGAACAAGG - Intergenic
992297298 5:75337662-75337684 CTGCCTACTCTGACTGAACAGGG - Intronic
992315278 5:75546448-75546470 CAGGTGACTCTTAGACAACACGG - Intronic
994283176 5:97930803-97930825 CTGCTAACTCTGAAAGCACATGG - Intergenic
999757321 5:154674356-154674378 CAGGTTTATCTGAGAGACCAGGG - Intergenic
1001856075 5:175012056-175012078 CATGTTTCTGTGAGAGAACAGGG - Intergenic
1002453354 5:179331752-179331774 CTGGGGGCTCTGATAGAACAAGG - Intronic
1006746955 6:36349573-36349595 CTGGTTATTCTTACAAAACATGG - Intergenic
1006878641 6:37320119-37320141 CTGGTTACACTTGAAGAACAGGG + Intronic
1006902915 6:37514514-37514536 ATGATTACTCTCAGCGAACAAGG - Intergenic
1007714460 6:43847690-43847712 CTGCTTGCTCTGAGAGATTAGGG + Intergenic
1008164280 6:48116856-48116878 CTGGCTACTCAGAGAAGACATGG - Intergenic
1008694558 6:54019435-54019457 CTGGTATCTCTGAGAAAAAATGG - Intronic
1008828548 6:55729886-55729908 CTGATTTCTCTTAGAGAGCAGGG + Intergenic
1010304346 6:74301474-74301496 ATGGTAACTCTGTGAGAAGATGG + Intergenic
1012340569 6:98117275-98117297 CTCCTCACTCTCAGAGAACAAGG - Intergenic
1014307678 6:119762633-119762655 CTGGTTGATCTTAGAGAACATGG + Intergenic
1015783631 6:136898427-136898449 CTGATTTCCCTGAGAGAAAAAGG + Intronic
1018091878 6:160352755-160352777 CTAGTTACTCTGAGGGACAAGGG - Intronic
1018847949 6:167568070-167568092 CTGGCCACTGAGAGAGAACATGG - Intergenic
1019162790 6:170080408-170080430 GTGCTTACTCTGAGGAAACAGGG - Intergenic
1020804532 7:12772374-12772396 CAGGTTACTCTGAGGGAAGTGGG + Intergenic
1022205109 7:28156265-28156287 CTGGTTCCTCTGTGTGAAAAGGG - Intronic
1022604202 7:31792252-31792274 CTGCTGACTCTTTGAGAACAGGG + Intronic
1023090014 7:36608827-36608849 CTGGACACTTTGAGAGAAGAGGG - Intronic
1023591789 7:41788167-41788189 ATGGATACCCTAAGAGAACATGG - Intergenic
1024842924 7:53608135-53608157 ATGGTTACTCTGAAAGTACTGGG - Intergenic
1028739652 7:94259009-94259031 CTGGTGCCTGTGAGAAAACAAGG + Intergenic
1032346028 7:131117732-131117754 ATGGTTCCTGTGAGAGATCATGG + Intronic
1037896685 8:22661208-22661230 GTGGTTACTCTAGGATAACAAGG - Intronic
1040552819 8:48451539-48451561 CTGGTTACGCTGGGAGAATCTGG + Intergenic
1042822355 8:72944203-72944225 CTGGTCAGTCTGAGAGAAGGTGG + Intergenic
1045518794 8:102884995-102885017 CTGGCTCCTCTGAGAGAACCTGG - Intronic
1046202930 8:110950930-110950952 CCAGTCACTCTGAGAGATCAAGG + Intergenic
1049021693 8:139961528-139961550 CTGGCTCCCCTGAGAGCACAGGG - Intronic
1049437193 8:142592199-142592221 CTGGATTCTCTGGGAAAACAGGG - Intergenic
1050263785 9:3869037-3869059 CTGGATACTCTGAGAGGGCAAGG + Intronic
1051168746 9:14295925-14295947 CTGGTAAATCTGAGACAAAAAGG + Intronic
1052341334 9:27367023-27367045 CTGGCCACTCTGTGAGAGCAGGG + Intronic
1052443604 9:28530475-28530497 ATGTTTACTCTGAGAGGAAATGG - Intronic
1053213104 9:36248289-36248311 TTGAATAATCTGAGAGAACAAGG - Intronic
1059305892 9:113352806-113352828 GTGGTTCCTGTGAGAGATCATGG + Intronic
1059769360 9:117412699-117412721 CGGGGTACTCTGAGAGATGAGGG - Intronic
1060302654 9:122384333-122384355 CTGGTGACTCAGAGCGAACATGG - Intronic
1062050997 9:134447037-134447059 CTGATCACTCTGTGGGAACAAGG - Intergenic
1188310780 X:28613859-28613881 ATTTTAACTCTGAGAGAACATGG + Intronic
1192434337 X:71133652-71133674 CTGCATACTTTCAGAGAACAAGG - Intronic