ID: 983308897

View in Genome Browser
Species Human (GRCh38)
Location 4:166030444-166030466
Sequence AGTGAAAATACAACCTGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 216}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983308897 Original CRISPR AGTGAAAATACAACCTGTGA AGG (reversed) Intronic
905380540 1:37558638-37558660 AGTGAAAACACCAGCTGTCAGGG - Intronic
908011534 1:59783070-59783092 AGAGAAAATAGCACCTGGGAGGG + Intergenic
909221615 1:72969448-72969470 ATTGAATATACAGCTTGTGAAGG - Intergenic
910441622 1:87258687-87258709 AATCAAAAAACAACCTGTGTTGG - Intergenic
912662115 1:111541260-111541282 AGTGAAAATACAAACCATAATGG + Intronic
912871333 1:113309786-113309808 AGTGAAAACACAACTTTTAATGG - Intergenic
915864330 1:159482399-159482421 AATGAAACTAGAACCTGTGAAGG + Intergenic
916305900 1:163332158-163332180 AATGAAAATACAACATATCAAGG - Intronic
918375359 1:183903653-183903675 AGTTATAATACAACCTGAAAAGG + Intronic
923562807 1:235054448-235054470 AGGGAACATACAACTGGTGAGGG - Intergenic
923881573 1:238109474-238109496 AGTGAAAAACCAACCTGTGAAGG + Intergenic
924401855 1:243691883-243691905 AGAGAAAGTACAAAGTGTGAAGG + Intronic
1065341125 10:24706899-24706921 AATGAAAACACAACCTGGGGAGG + Intronic
1068182755 10:53543803-53543825 AGTGAAAAGACAACCTACAATGG - Intergenic
1068848357 10:61706814-61706836 ACAGAAACTATAACCTGTGAAGG - Intronic
1068908160 10:62350481-62350503 AATGGAAATAGAATCTGTGATGG + Intergenic
1069000286 10:63255140-63255162 AGTCAAAAAAGAACCTGTGTTGG - Intronic
1069693174 10:70367908-70367930 TGTGAAAATAGAATCTGTGAGGG - Intronic
1071186397 10:83050977-83050999 AGTGAAAATAAAACCTGTAAAGG + Intergenic
1071414057 10:85424430-85424452 AGTGTAGATACTACCTGGGACGG - Intergenic
1071889626 10:89989021-89989043 AGTGAAAAAACAATGTGTGCTGG - Intergenic
1073662617 10:105493594-105493616 AGGGGAAAAACAACCTGTTAGGG + Intergenic
1076295485 10:129380659-129380681 AATGAAAACACAAGCGGTGAAGG + Intergenic
1077731291 11:4732838-4732860 AATGAATATACAAAATGTGATGG - Intronic
1077949550 11:6941214-6941236 AGTAGAATTACAGCCTGTGATGG + Intronic
1079310109 11:19357887-19357909 AGTAAAAATGCAACCTGTAAGGG - Intronic
1079315249 11:19402489-19402511 GGTAAAAATACAGACTGTGAAGG - Intronic
1079513052 11:21233471-21233493 AGTTAGAATACAATGTGTGAGGG - Intronic
1081148407 11:39595044-39595066 AATGTAATTACAAACTGTGATGG + Intergenic
1082110665 11:48270347-48270369 AGTGAATGTACAACATGTGCTGG + Intergenic
1083244755 11:61418065-61418087 CTTGAAAATACAACTTGTCAAGG + Intronic
1086376254 11:86203833-86203855 ACTGAAAATACAAAGTGTGGTGG + Intergenic
1087534843 11:99430142-99430164 AGTGAAAAAACATCTTGAGAAGG - Intronic
1087656309 11:100927447-100927469 AGTAAAAATAAAATCTGTAATGG + Intronic
1087796339 11:102458373-102458395 AGTGAAAATAAAACAAGTAAAGG + Intronic
1090158811 11:124469811-124469833 CGTGCAAATAAATCCTGTGAAGG - Intergenic
1090726260 11:129530086-129530108 AGTGAAGATACAATCTGAGCAGG + Intergenic
1094644571 12:32309920-32309942 TATGAAAATACAAACTGTCAGGG - Intronic
1096177514 12:49532729-49532751 AGTGAACATTCAACTTGTCATGG - Intergenic
1099288869 12:80750000-80750022 AGTAAAAATACAATATGTGTAGG + Intergenic
1100729712 12:97451205-97451227 AGTGAAAAGACAACCTAGAATGG - Intergenic
1101429103 12:104612139-104612161 AGTGAATATGCAATCAGTGAGGG - Intronic
1101480609 12:105093149-105093171 AGTAAAAATCCAAACAGTGATGG + Intergenic
1105254583 13:18734555-18734577 TGTGAAAAGAAACCCTGTGAAGG + Intergenic
1106020274 13:25907711-25907733 AGTGTAAAGAAAGCCTGTGATGG - Intronic
1108569916 13:51739491-51739513 CTTGAAAATACAAGCTGTGAAGG + Intronic
1109080767 13:57897155-57897177 AGTGAGAATATGACCTGTGGTGG + Intergenic
1109238630 13:59855109-59855131 AGTGCAAATATAAACTGTGTTGG - Intronic
1109559220 13:64025041-64025063 AGTGAAAATATAAGCTGGAAAGG + Intergenic
1110270826 13:73588318-73588340 AGTGAAAAGACAACAGGTGTTGG + Intergenic
1110356861 13:74576540-74576562 AGAGAAAACAAAACCTGGGATGG + Intergenic
1111433077 13:88168983-88169005 ATTGAAAATACAGCATTTGAGGG - Intergenic
1112470247 13:99681989-99682011 TGTGGAAATACATTCTGTGATGG - Intronic
1112877726 13:104065726-104065748 GGTGTAAATACAACCTGCAAAGG - Intergenic
1113837887 13:113340888-113340910 AGAGAAAATAGAACATCTGATGG - Intronic
1114582677 14:23776673-23776695 AGTCAAAATGCTAGCTGTGAAGG + Intergenic
1115652915 14:35416098-35416120 AGTGAAAAGACAAAGTGAGAAGG - Intergenic
1116045832 14:39741009-39741031 AGTGAACATAGAAGTTGTGATGG + Intergenic
1116254994 14:42542159-42542181 AGTCAAAACACAGCCAGTGAAGG - Intergenic
1116855546 14:49949182-49949204 AGTGAAAATATAAGCTGGGCTGG + Intergenic
1117116278 14:52516678-52516700 AGGGAAAATAAAACCTGAAAAGG - Intronic
1119047857 14:71336593-71336615 ACAGAAACTACAACCTGTGCTGG + Intronic
1119653394 14:76399414-76399436 AGTGCACATCCAACCTGTGTTGG - Intronic
1120530327 14:85623241-85623263 AGTGGAAATACAACCGGGGCCGG + Exonic
1123498039 15:20850059-20850081 AATGAAAATAAAGCCTGTCAGGG + Intronic
1123555270 15:21423687-21423709 AATGAAAATAAAGCCTGTCAGGG + Intronic
1123591515 15:21861018-21861040 AATGAAAATAAAGCCTGTCAGGG + Intergenic
1125148150 15:36497298-36497320 AGTGAAAATATGACCTCTGTAGG - Intergenic
1126375014 15:47988854-47988876 AATGAAAATTCAGCCTCTGATGG + Intergenic
1127378717 15:58409140-58409162 AACGAAAACACAACCTGAGATGG + Intronic
1129406442 15:75322274-75322296 AGTGAAAATAGAATCTTTGGAGG - Intergenic
1130128753 15:81118159-81118181 AGTGAAAATAGAATCTTTGGAGG - Intronic
1131891870 15:96981542-96981564 ATTGTAAATACAATCTTTGAGGG - Intergenic
1202963616 15_KI270727v1_random:150896-150918 AATGAAAATAAAGCCTGTCAGGG + Intergenic
1135351224 16:21730790-21730812 AGTGAAAAAACATGCTGTGGTGG - Intronic
1135449705 16:22546916-22546938 AGTGAAAAAACATGCTGTGGTGG - Intergenic
1137779093 16:51081965-51081987 GGAGAAAATACTACCTGTGTAGG + Intergenic
1143241214 17:5444723-5444745 AGGGAAACTACCGCCTGTGAAGG + Intronic
1144369228 17:14574145-14574167 AGTGATAATTCAACTTGGGAGGG - Intergenic
1146070596 17:29677493-29677515 AGTAAAAATACAACTTGCCAGGG - Intronic
1147815811 17:43209415-43209437 TGGGAAATTACAACCTGGGAAGG - Intronic
1149020691 17:51960827-51960849 AATGAAAATACCACAAGTGATGG + Intronic
1151352345 17:73539268-73539290 AGTGAAAAAACAACCATTAACGG + Intronic
1151782349 17:76255755-76255777 AGGGAAAATTGAACCTGGGAAGG + Intergenic
1154436445 18:14346073-14346095 TGTGAAAAGAAACCCTGTGAAGG - Intergenic
1154456040 18:14526488-14526510 AATGAAAATAAAGCCTGTCAGGG + Intronic
1159873057 18:73779976-73779998 AGTGAACATAGAACATTTGATGG + Intergenic
1160677112 19:397377-397399 AATGAAAACGCCACCTGTGACGG + Intergenic
1164143388 19:22494084-22494106 AGTGAAAACTCAAGGTGTGATGG - Intronic
1164262858 19:23583354-23583376 GGAGAAAATACAACCTGTAAGGG - Intronic
1167231455 19:48287008-48287030 TGTGAAAAAAAACCCTGTGAAGG + Exonic
925178327 2:1800313-1800335 AGGGAAATTCCAACCTGTGTTGG + Intronic
925556418 2:5135491-5135513 AGTGAATATACAAGATGTAATGG + Intergenic
926773174 2:16396436-16396458 AGGGAAAATCCCTCCTGTGATGG + Intergenic
928288920 2:30020222-30020244 AGTGAAAAAATAACGTGTCAGGG - Intergenic
928839865 2:35592517-35592539 TGTGAAAATACAATTTCTGATGG + Intergenic
928947882 2:36788294-36788316 TGTTAAAATAAAACCTCTGAAGG - Intronic
929251099 2:39756519-39756541 TTTTAAAATACAAGCTGTGAAGG + Intronic
933089452 2:78103166-78103188 AGTGAAAATAAAACCTATTAGGG + Intergenic
933274354 2:80267595-80267617 AATGACAATACAAGCTGGGAAGG + Intronic
933374203 2:81458634-81458656 AGTAGAAATTCAACCTGTTAAGG + Intergenic
935879763 2:107552465-107552487 AATGAAAAAACAATATGTGAAGG - Intergenic
936696262 2:114952682-114952704 AGTGTGAATACAACATGTGTTGG + Intronic
937950477 2:127383267-127383289 AGTGACCATACAACCTGATATGG - Intronic
938122521 2:128644059-128644081 AGGGAAATTACACCCTGTAATGG + Intergenic
939110410 2:138000042-138000064 GGTGAAAATTCAGCCTGTAAGGG - Intronic
939726779 2:145730358-145730380 AAGGGAAATACAACCTTTGATGG - Intergenic
939859496 2:147400813-147400835 AGTGAAGATACAATCCGTGCAGG - Intergenic
941063273 2:160872141-160872163 AGTGGAAACACAAGGTGTGAGGG + Intergenic
944373658 2:199014335-199014357 AGTGATAATGCAACCAGTGATGG - Intergenic
944653171 2:201852060-201852082 AGTGAAGAGACAACCTACGATGG - Intronic
946529918 2:220559935-220559957 AGTGAAGAGAGAACCTGTGGGGG - Intergenic
1169240546 20:3975542-3975564 AGTAAAAAAACAACCAGTTATGG + Intronic
1169644907 20:7799299-7799321 AGTGAGAATCAAAACTGTGATGG - Intergenic
1170457949 20:16551099-16551121 AGTGAAGAAACCACCAGTGAGGG + Intronic
1170747141 20:19110229-19110251 AGAGAAAATACAATCTGGAAAGG - Intergenic
1170755647 20:19204090-19204112 AAAGAAAATACAACCTGTAGAGG + Intergenic
1172971117 20:38873634-38873656 TGTGAAAAGACCACCAGTGAGGG - Intronic
1174891987 20:54405148-54405170 AGTGAAAATATAACGTGTTAGGG + Intergenic
1175135976 20:56824410-56824432 AGTGAAAACAAGACCTGGGAGGG + Intergenic
1176818122 21:13626852-13626874 AATGAAAATAAAGCCTGTCAGGG - Intronic
1176840597 21:13839587-13839609 TGTGAAAAGAAACCCTGTGAAGG + Intergenic
1179565933 21:42248922-42248944 AGCGAATAAACAAACTGTGATGG + Intronic
949399797 3:3654131-3654153 ACTGAAAATGCAACCTGTGTGGG - Intergenic
950344471 3:12279752-12279774 ACTGAAAATACAACTTGTAATGG + Intergenic
951109002 3:18778978-18779000 AGAGAAAATGCAACCAGTAAAGG - Intergenic
953268864 3:41419910-41419932 AGTGCCAAAACACCCTGTGAGGG - Intronic
958443979 3:94192327-94192349 AGTTAGAATAAAACCTGTGGTGG - Intergenic
958977662 3:100685314-100685336 TGTGAAAATAAAGCCTGAGAAGG + Intronic
960881718 3:122352303-122352325 AGTGGAAATACTAGCTGTAATGG + Intergenic
962235550 3:133704149-133704171 AGTGAAATGAGAACCTCTGAGGG + Intergenic
963677378 3:148329416-148329438 TGTGAAAATACAAATTTTGAGGG - Intergenic
965235629 3:166117344-166117366 AAATAAAATACAAACTGTGATGG - Intergenic
966041046 3:175488589-175488611 AGTAAAATTAGAACATGTGAGGG - Intronic
966706922 3:182926245-182926267 AGAGAAAATAGAAACTGTAAGGG - Intergenic
971816699 4:31499743-31499765 AGTGAAAAGACAACAGGTGCTGG - Intergenic
972749687 4:41976033-41976055 AGGCAAAATACAACCAGTGGAGG - Intergenic
974667769 4:64987284-64987306 AAAGCAAATACATCCTGTGAAGG + Intergenic
975036064 4:69684314-69684336 AGAAAAAATAAAACCTGTCATGG - Intergenic
975410103 4:74038959-74038981 GCTGAAGATACAGCCTGTGAGGG + Intergenic
975833099 4:78390909-78390931 ACAGAAAACACAACCTGTCAAGG + Intronic
976711787 4:88080096-88080118 AAGGAAAAAACAACCTTTGATGG + Intergenic
977282181 4:95054506-95054528 AGTGAAAATGTGACCTGTAATGG + Intronic
977465534 4:97379669-97379691 TGTGAAAACACTACCTGAGATGG + Intronic
977982282 4:103338299-103338321 AGTAAAAAAAAAACATGTGAAGG + Intergenic
980409371 4:132396241-132396263 TGTGAAAATAAGACCTTTGATGG + Intergenic
982340874 4:154297291-154297313 AGAGCAAATATAACGTGTGAAGG - Intronic
982844939 4:160239427-160239449 TGTGAAAATACAACATATCAAGG - Intergenic
983308897 4:166030444-166030466 AGTGAAAATACAACCTGTGAAGG - Intronic
985110195 4:186540343-186540365 ATTGAAAATACAATATTTGAGGG - Intronic
985904760 5:2824860-2824882 AGTGAAAATACCACGGGGGATGG + Intergenic
986365068 5:7021451-7021473 AGTGAAAATTCAGGGTGTGATGG + Intergenic
986558875 5:9040382-9040404 TGTGAAAGTCCAACATGTGAGGG + Exonic
986714092 5:10510244-10510266 AGGGAAAATACAAAGTGTGTGGG + Intronic
988691678 5:33578657-33578679 ACTGAAAATAGAACTTGAGAAGG - Intronic
991060162 5:62366215-62366237 AGTTAAAATACAAACTCTGAAGG - Intronic
991512230 5:67392186-67392208 GGGGAGAATACAACCTGTTAAGG + Intergenic
992466604 5:77012275-77012297 ATTGAAAATACAGCTTGTGGTGG - Intergenic
993216260 5:85026613-85026635 AGTGAAAAAAAAAACTATGAAGG - Intergenic
994133788 5:96262212-96262234 AGTGAAAAGAGAACGTGTGGTGG + Intergenic
994509549 5:100686825-100686847 AGTGACAATACCACATGTAAGGG + Intergenic
996643977 5:125792904-125792926 AGTGAACATACTACCAGGGAAGG - Intergenic
1000398942 5:160804983-160805005 ATTGAAAATACAATATTTGAGGG - Intronic
1001022218 5:168192837-168192859 ACTGAAAATGCATCCTCTGAAGG + Intronic
1001302632 5:170547185-170547207 AGTAACATCACAACCTGTGACGG - Intronic
1001910098 5:175509172-175509194 CGTCATCATACAACCTGTGATGG - Exonic
1003382542 6:5638241-5638263 AGAGAATATACAAGCTGTTAGGG + Intronic
1005320027 6:24644201-24644223 TGTGAAAGTGCACCCTGTGATGG + Intronic
1013031548 6:106338492-106338514 AGTTTAATTACAGCCTGTGAGGG - Intergenic
1013420865 6:109965589-109965611 ATTGAGACTACAGCCTGTGACGG - Intergenic
1015149813 6:130024377-130024399 AGTAAAACTAAAACCTGTCAGGG - Intronic
1016127009 6:140416180-140416202 AGTAAAAATTAAAACTGTGATGG + Intergenic
1019975325 7:4576687-4576709 AGTGCAAATTCAGGCTGTGATGG + Intergenic
1020453846 7:8349467-8349489 TGAGAAGATACAACCTTTGATGG - Intergenic
1020495857 7:8852616-8852638 AGTGAAAATAAAAACTGTCTGGG + Intergenic
1021572984 7:22083749-22083771 AGTGAAAATATATCATGTGAGGG - Intergenic
1021953519 7:25799024-25799046 AGTGAAAATGCAACATATCAAGG + Intergenic
1022208118 7:28182041-28182063 AGAGAAAATGCCACCGGTGATGG - Intergenic
1025008409 7:55374472-55374494 ATTGAAAATACCACTAGTGAAGG + Intronic
1028580218 7:92402120-92402142 AGTGATAATACAAACTTTGGGGG + Intergenic
1029904687 7:104079566-104079588 AGTGAAAATTGAACCTGAGCAGG + Intergenic
1030259756 7:107550664-107550686 AGAGAAAATAAAACAGGTGATGG - Intronic
1031019944 7:116616472-116616494 AATAAAAATATAGCCTGTGAGGG - Intergenic
1032661414 7:133988033-133988055 AGTCAACATACAAACTGTCATGG - Intronic
1032917932 7:136512171-136512193 AGTGAAAATTCAGGGTGTGAGGG + Intergenic
1032964610 7:137081321-137081343 GGGGAAAATAAAATCTGTGAAGG - Intergenic
1033381470 7:140824082-140824104 AGTGAAAAGCCAACCTGGAATGG - Intronic
1033779941 7:144657049-144657071 AGTAAAACTGCATCCTGTGAAGG - Intronic
1033809985 7:145001523-145001545 AGTGACAACAGAACCTGTGCTGG + Intergenic
1033870870 7:145752066-145752088 AGTGAAAATTCAGGGTGTGATGG + Intergenic
1033926820 7:146472007-146472029 AGTGAAAATAAAAGCTCTCATGG + Intronic
1034376094 7:150645838-150645860 AGGGAAGAGAAAACCTGTGAAGG - Intergenic
1035995376 8:4540607-4540629 AGTGAAAATAAACCTTGAGAGGG + Intronic
1037631342 8:20659372-20659394 AGTGAAAAGCCAATCTGAGAAGG + Intergenic
1038156310 8:24994009-24994031 AGGAAAAATACTACCTTTGATGG - Intergenic
1040066415 8:43148298-43148320 AATTAAAATTCAACCTCTGATGG - Intronic
1040696987 8:50011849-50011871 TCAGAACATACAACCTGTGAAGG - Intronic
1040875867 8:52151299-52151321 ATTGAAAATACAAACTTTGCAGG - Intronic
1041284722 8:56248467-56248489 AGTGTAAATAAAAGCTCTGAAGG - Intergenic
1041293027 8:56325338-56325360 AGTGGAAATACTATTTGTGAAGG + Intergenic
1041703792 8:60822752-60822774 ACAAAGAATACAACCTGTGAAGG - Intronic
1041856090 8:62456639-62456661 GGTGAAAGTACAAACTGTGTTGG - Intronic
1042214533 8:66416807-66416829 AGTAAAAATCCAACCAGTAATGG + Intergenic
1043478566 8:80629240-80629262 ACTGTAAATACAGCCTGTGGAGG - Exonic
1045144931 8:99331578-99331600 AATTAAAATATAACCTGTAAGGG + Intronic
1045440132 8:102201145-102201167 AGTGAAGATCCACCATGTGAAGG - Intergenic
1045800116 8:106092531-106092553 AATGAAATTACAGACTGTGATGG + Intergenic
1047863221 8:128991778-128991800 AGTGAAAATAAAACTGGAGAAGG - Intergenic
1048911216 8:139136937-139136959 AGTGAAAATATCACCTGCAATGG + Intergenic
1052224374 9:26067265-26067287 CTTGAAAATACAAGCTGTTAAGG - Intergenic
1055594998 9:77857127-77857149 AGTGAAATTCAAACCTGTCAAGG + Intronic
1055998360 9:82187270-82187292 AGAGAAAATACAACCTACAAGGG - Intergenic
1057616038 9:96591046-96591068 AGTGAAAAGACAACCTAGAATGG - Intronic
1057774763 9:97998565-97998587 AGTGAAAATAGAATCTTTGGAGG + Exonic
1203529237 Un_GL000213v1:122652-122674 AATGAAAATAAAGCCTGTCAGGG + Intergenic
1185749863 X:2602249-2602271 AGTCAAAACACAACCGGTGCTGG + Intergenic
1185994004 X:4923744-4923766 TGTAAAAATACAAACTGTGTGGG + Intergenic
1186714230 X:12233168-12233190 ATTTAAAATACACCCTGGGAGGG - Intronic
1188652315 X:32646576-32646598 AGAGAAAATTCAACCTTTGGTGG + Intronic
1189220284 X:39365901-39365923 AGTGAACATACAACCTGTTGGGG + Intergenic
1189954056 X:46260537-46260559 ACTGAAACTACAACCAGTCAGGG + Intergenic
1192751746 X:73999068-73999090 AGTGAAAATACAAAATTAGACGG - Intergenic
1193045090 X:77045162-77045184 AGAAAAAATACAACCTATCAAGG + Intergenic
1193318428 X:80092148-80092170 AATGAAAAAACAGCCTGGGAGGG + Intergenic
1194327267 X:92535011-92535033 AGTCAAAATACAACAGATGATGG + Intronic
1195938778 X:110149553-110149575 TGAGAAAAAATAACCTGTGAAGG - Intronic
1196246456 X:113405187-113405209 TGTGAAAATTCAACATGTGTGGG - Intergenic
1196361185 X:114861646-114861668 AATCAAAATATAACCTGTGTTGG - Intronic
1197344126 X:125311455-125311477 AGTTAAAACACAATCTGGGAAGG + Intergenic
1198913957 X:141645791-141645813 AGTGAAAAGACAACCGGGGTTGG - Intronic
1200635983 Y:5654219-5654241 AGTCAAAATACAACAGATGATGG + Intronic
1201683586 Y:16677251-16677273 AAGGAAGATTCAACCTGTGATGG + Intergenic