ID: 983314184

View in Genome Browser
Species Human (GRCh38)
Location 4:166106552-166106574
Sequence CTGCCCTAACTGGTGGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983314180_983314184 -4 Left 983314180 4:166106533-166106555 CCATTATCTCCAATCAATGCTGC No data
Right 983314184 4:166106552-166106574 CTGCCCTAACTGGTGGAAAAAGG No data
983314179_983314184 -3 Left 983314179 4:166106532-166106554 CCCATTATCTCCAATCAATGCTG No data
Right 983314184 4:166106552-166106574 CTGCCCTAACTGGTGGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983314184 Original CRISPR CTGCCCTAACTGGTGGAAAA AGG Intergenic
No off target data available for this crispr