ID: 983316370

View in Genome Browser
Species Human (GRCh38)
Location 4:166137309-166137331
Sequence GGTGACTGGATGAAGGTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983316370_983316373 -6 Left 983316370 4:166137309-166137331 CCATTCACCTTCATCCAGTCACC No data
Right 983316373 4:166137326-166137348 GTCACCCAAGCTACAAACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983316370 Original CRISPR GGTGACTGGATGAAGGTGAA TGG (reversed) Intergenic
No off target data available for this crispr