ID: 983317462

View in Genome Browser
Species Human (GRCh38)
Location 4:166149964-166149986
Sequence TATAAAAGGCTGCCCGAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983317462_983317464 5 Left 983317462 4:166149964-166149986 CCAGTCTCGGGCAGCCTTTTATA No data
Right 983317464 4:166149992-166150014 ATGAGAATGAACTAATATATTGG No data
983317462_983317465 18 Left 983317462 4:166149964-166149986 CCAGTCTCGGGCAGCCTTTTATA No data
Right 983317465 4:166150005-166150027 AATATATTGGTACATTCTTTTGG No data
983317462_983317466 19 Left 983317462 4:166149964-166149986 CCAGTCTCGGGCAGCCTTTTATA No data
Right 983317466 4:166150006-166150028 ATATATTGGTACATTCTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983317462 Original CRISPR TATAAAAGGCTGCCCGAGAC TGG (reversed) Intergenic
No off target data available for this crispr