ID: 983317464

View in Genome Browser
Species Human (GRCh38)
Location 4:166149992-166150014
Sequence ATGAGAATGAACTAATATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983317463_983317464 -9 Left 983317463 4:166149978-166150000 CCTTTTATAGCAGCATGAGAATG No data
Right 983317464 4:166149992-166150014 ATGAGAATGAACTAATATATTGG No data
983317457_983317464 26 Left 983317457 4:166149943-166149965 CCTCTTTCCTTTATAAATTACCC 0: 3442
1: 8020
2: 8919
3: 8212
4: 5079
Right 983317464 4:166149992-166150014 ATGAGAATGAACTAATATATTGG No data
983317462_983317464 5 Left 983317462 4:166149964-166149986 CCAGTCTCGGGCAGCCTTTTATA No data
Right 983317464 4:166149992-166150014 ATGAGAATGAACTAATATATTGG No data
983317461_983317464 6 Left 983317461 4:166149963-166149985 CCCAGTCTCGGGCAGCCTTTTAT No data
Right 983317464 4:166149992-166150014 ATGAGAATGAACTAATATATTGG No data
983317458_983317464 19 Left 983317458 4:166149950-166149972 CCTTTATAAATTACCCAGTCTCG 0: 590
1: 4234
2: 4908
3: 3108
4: 1529
Right 983317464 4:166149992-166150014 ATGAGAATGAACTAATATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983317464 Original CRISPR ATGAGAATGAACTAATATAT TGG Intergenic
No off target data available for this crispr