ID: 983317465

View in Genome Browser
Species Human (GRCh38)
Location 4:166150005-166150027
Sequence AATATATTGGTACATTCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983317462_983317465 18 Left 983317462 4:166149964-166149986 CCAGTCTCGGGCAGCCTTTTATA No data
Right 983317465 4:166150005-166150027 AATATATTGGTACATTCTTTTGG No data
983317461_983317465 19 Left 983317461 4:166149963-166149985 CCCAGTCTCGGGCAGCCTTTTAT No data
Right 983317465 4:166150005-166150027 AATATATTGGTACATTCTTTTGG No data
983317463_983317465 4 Left 983317463 4:166149978-166150000 CCTTTTATAGCAGCATGAGAATG No data
Right 983317465 4:166150005-166150027 AATATATTGGTACATTCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983317465 Original CRISPR AATATATTGGTACATTCTTT TGG Intergenic
No off target data available for this crispr