ID: 983317466

View in Genome Browser
Species Human (GRCh38)
Location 4:166150006-166150028
Sequence ATATATTGGTACATTCTTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983317463_983317466 5 Left 983317463 4:166149978-166150000 CCTTTTATAGCAGCATGAGAATG No data
Right 983317466 4:166150006-166150028 ATATATTGGTACATTCTTTTGGG No data
983317461_983317466 20 Left 983317461 4:166149963-166149985 CCCAGTCTCGGGCAGCCTTTTAT No data
Right 983317466 4:166150006-166150028 ATATATTGGTACATTCTTTTGGG No data
983317462_983317466 19 Left 983317462 4:166149964-166149986 CCAGTCTCGGGCAGCCTTTTATA No data
Right 983317466 4:166150006-166150028 ATATATTGGTACATTCTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983317466 Original CRISPR ATATATTGGTACATTCTTTT GGG Intergenic
No off target data available for this crispr