ID: 983319083

View in Genome Browser
Species Human (GRCh38)
Location 4:166172421-166172443
Sequence ACAAAAATGCAGAAACTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983319083_983319086 8 Left 983319083 4:166172421-166172443 CCTTCCAGTTTCTGCATTTTTGT No data
Right 983319086 4:166172452-166172474 AATTGCTTCAGAAAATTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983319083 Original CRISPR ACAAAAATGCAGAAACTGGA AGG (reversed) Intergenic
No off target data available for this crispr