ID: 983323830

View in Genome Browser
Species Human (GRCh38)
Location 4:166227881-166227903
Sequence ATACATGGACAACTGGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983323830_983323839 28 Left 983323830 4:166227881-166227903 CCTTGCTCCAGTTGTCCATGTAT No data
Right 983323839 4:166227932-166227954 CTTGGGACCTGCTGAATGGAGGG No data
983323830_983323838 27 Left 983323830 4:166227881-166227903 CCTTGCTCCAGTTGTCCATGTAT No data
Right 983323838 4:166227931-166227953 ACTTGGGACCTGCTGAATGGAGG 0: 13
1: 28
2: 56
3: 103
4: 236
983323830_983323834 -2 Left 983323830 4:166227881-166227903 CCTTGCTCCAGTTGTCCATGTAT No data
Right 983323834 4:166227902-166227924 ATCTCATTCTTCTCAGACATGGG No data
983323830_983323836 11 Left 983323830 4:166227881-166227903 CCTTGCTCCAGTTGTCCATGTAT No data
Right 983323836 4:166227915-166227937 CAGACATGGGACAAGAACTTGGG No data
983323830_983323835 10 Left 983323830 4:166227881-166227903 CCTTGCTCCAGTTGTCCATGTAT No data
Right 983323835 4:166227914-166227936 TCAGACATGGGACAAGAACTTGG No data
983323830_983323837 24 Left 983323830 4:166227881-166227903 CCTTGCTCCAGTTGTCCATGTAT No data
Right 983323837 4:166227928-166227950 AGAACTTGGGACCTGCTGAATGG 0: 18
1: 59
2: 116
3: 193
4: 351
983323830_983323833 -3 Left 983323830 4:166227881-166227903 CCTTGCTCCAGTTGTCCATGTAT No data
Right 983323833 4:166227901-166227923 TATCTCATTCTTCTCAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983323830 Original CRISPR ATACATGGACAACTGGAGCA AGG (reversed) Intergenic
No off target data available for this crispr