ID: 983324276

View in Genome Browser
Species Human (GRCh38)
Location 4:166233491-166233513
Sequence CTGGGTAGGTGGCATGTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983324268_983324276 12 Left 983324268 4:166233456-166233478 CCTCTCTTTTTTTCCCTAGAGAA No data
Right 983324276 4:166233491-166233513 CTGGGTAGGTGGCATGTGGACGG No data
983324267_983324276 23 Left 983324267 4:166233445-166233467 CCACAAACAGTCCTCTCTTTTTT No data
Right 983324276 4:166233491-166233513 CTGGGTAGGTGGCATGTGGACGG No data
983324269_983324276 -1 Left 983324269 4:166233469-166233491 CCCTAGAGAATAAAGAGTACTGC No data
Right 983324276 4:166233491-166233513 CTGGGTAGGTGGCATGTGGACGG No data
983324270_983324276 -2 Left 983324270 4:166233470-166233492 CCTAGAGAATAAAGAGTACTGCT No data
Right 983324276 4:166233491-166233513 CTGGGTAGGTGGCATGTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983324276 Original CRISPR CTGGGTAGGTGGCATGTGGA CGG Intergenic
No off target data available for this crispr