ID: 983327431

View in Genome Browser
Species Human (GRCh38)
Location 4:166274578-166274600
Sequence CCCAGCGGGTACCCCGAGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983327431_983327440 4 Left 983327431 4:166274578-166274600 CCGGACTCGGGGTACCCGCTGGG No data
Right 983327440 4:166274605-166274627 GTGGGGCTGGTTTCCCCAACAGG No data
983327431_983327445 22 Left 983327431 4:166274578-166274600 CCGGACTCGGGGTACCCGCTGGG No data
Right 983327445 4:166274623-166274645 ACAGGTTTGTGCAAAGCAGGAGG No data
983327431_983327438 -9 Left 983327431 4:166274578-166274600 CCGGACTCGGGGTACCCGCTGGG No data
Right 983327438 4:166274592-166274614 CCCGCTGGGTGGTGTGGGGCTGG No data
983327431_983327444 19 Left 983327431 4:166274578-166274600 CCGGACTCGGGGTACCCGCTGGG No data
Right 983327444 4:166274620-166274642 CCAACAGGTTTGTGCAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983327431 Original CRISPR CCCAGCGGGTACCCCGAGTC CGG (reversed) Intergenic
No off target data available for this crispr