ID: 983327642

View in Genome Browser
Species Human (GRCh38)
Location 4:166278643-166278665
Sequence CCCACTTAAGATTCCACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983327642_983327648 12 Left 983327642 4:166278643-166278665 CCCACAGTGGAATCTTAAGTGGG No data
Right 983327648 4:166278678-166278700 CTGAGTTTAATAAGATTCCAGGG No data
983327642_983327647 11 Left 983327642 4:166278643-166278665 CCCACAGTGGAATCTTAAGTGGG No data
Right 983327647 4:166278677-166278699 TCTGAGTTTAATAAGATTCCAGG No data
983327642_983327649 24 Left 983327642 4:166278643-166278665 CCCACAGTGGAATCTTAAGTGGG No data
Right 983327649 4:166278690-166278712 AGATTCCAGGGTTGATTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983327642 Original CRISPR CCCACTTAAGATTCCACTGT GGG (reversed) Intergenic