ID: 983328523

View in Genome Browser
Species Human (GRCh38)
Location 4:166291728-166291750
Sequence ATTGAGATGGGGAATATAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983328518_983328523 5 Left 983328518 4:166291700-166291722 CCTCTAATATGCAGTGGCAAGGA No data
Right 983328523 4:166291728-166291750 ATTGAGATGGGGAATATAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983328523 Original CRISPR ATTGAGATGGGGAATATAAG AGG Intergenic
No off target data available for this crispr