ID: 983335234

View in Genome Browser
Species Human (GRCh38)
Location 4:166383689-166383711
Sequence ATTGCCTTTAACCATGTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983335234_983335241 20 Left 983335234 4:166383689-166383711 CCATTAACATGGTTAAAGGCAAT No data
Right 983335241 4:166383732-166383754 ACCAATGTATTTTAAGAATTTGG No data
983335234_983335237 -3 Left 983335234 4:166383689-166383711 CCATTAACATGGTTAAAGGCAAT No data
Right 983335237 4:166383709-166383731 AATATCCCCTGGAGGAGATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983335234 Original CRISPR ATTGCCTTTAACCATGTTAA TGG (reversed) Intergenic