ID: 983339033

View in Genome Browser
Species Human (GRCh38)
Location 4:166434439-166434461
Sequence AGTTATCTGCAGAGAATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983339033_983339035 -2 Left 983339033 4:166434439-166434461 CCTTCCATTCTCTGCAGATAACT No data
Right 983339035 4:166434460-166434482 CTTCTCTTATTTTGAGAAACAGG No data
983339033_983339037 16 Left 983339033 4:166434439-166434461 CCTTCCATTCTCTGCAGATAACT No data
Right 983339037 4:166434478-166434500 ACAGGTATGGCTTCCTACTGAGG No data
983339033_983339036 3 Left 983339033 4:166434439-166434461 CCTTCCATTCTCTGCAGATAACT No data
Right 983339036 4:166434465-166434487 CTTATTTTGAGAAACAGGTATGG No data
983339033_983339039 30 Left 983339033 4:166434439-166434461 CCTTCCATTCTCTGCAGATAACT No data
Right 983339039 4:166434492-166434514 CTACTGAGGCTTAGAGACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983339033 Original CRISPR AGTTATCTGCAGAGAATGGA AGG (reversed) Intergenic
No off target data available for this crispr