ID: 983346921

View in Genome Browser
Species Human (GRCh38)
Location 4:166538646-166538668
Sequence CCTTATCTTCAGAAAGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983346916_983346921 -10 Left 983346916 4:166538633-166538655 CCAAAATTTAGTTCCTTATCTTC No data
Right 983346921 4:166538646-166538668 CCTTATCTTCAGAAAGGGGATGG No data
983346913_983346921 22 Left 983346913 4:166538601-166538623 CCTGACTAACCATGTCTGAGTAA No data
Right 983346921 4:166538646-166538668 CCTTATCTTCAGAAAGGGGATGG No data
983346915_983346921 -9 Left 983346915 4:166538632-166538654 CCCAAAATTTAGTTCCTTATCTT No data
Right 983346921 4:166538646-166538668 CCTTATCTTCAGAAAGGGGATGG No data
983346914_983346921 13 Left 983346914 4:166538610-166538632 CCATGTCTGAGTAACAAACTGTC No data
Right 983346921 4:166538646-166538668 CCTTATCTTCAGAAAGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983346921 Original CRISPR CCTTATCTTCAGAAAGGGGA TGG Intergenic
No off target data available for this crispr