ID: 983346939

View in Genome Browser
Species Human (GRCh38)
Location 4:166538832-166538854
Sequence ATGGCTTTCCCCTGAAGATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983346933_983346939 21 Left 983346933 4:166538788-166538810 CCTAGTCTGACATGACTCACAGT No data
Right 983346939 4:166538832-166538854 ATGGCTTTCCCCTGAAGATCAGG No data
983346932_983346939 28 Left 983346932 4:166538781-166538803 CCTTGTTCCTAGTCTGACATGAC No data
Right 983346939 4:166538832-166538854 ATGGCTTTCCCCTGAAGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983346939 Original CRISPR ATGGCTTTCCCCTGAAGATC AGG Intergenic
No off target data available for this crispr