ID: 983355222

View in Genome Browser
Species Human (GRCh38)
Location 4:166648279-166648301
Sequence TTGAATAAGAGTGATGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983355218_983355222 3 Left 983355218 4:166648253-166648275 CCCTGGCTAGAACTTCCAATACT 0: 55
1: 2235
2: 11031
3: 3912
4: 1531
Right 983355222 4:166648279-166648301 TTGAATAAGAGTGATGAGAAGGG No data
983355219_983355222 2 Left 983355219 4:166648254-166648276 CCTGGCTAGAACTTCCAATACTA 0: 59
1: 2094
2: 10900
3: 4313
4: 1662
Right 983355222 4:166648279-166648301 TTGAATAAGAGTGATGAGAAGGG No data
983355217_983355222 10 Left 983355217 4:166648246-166648268 CCAATTGCCCTGGCTAGAACTTC No data
Right 983355222 4:166648279-166648301 TTGAATAAGAGTGATGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983355222 Original CRISPR TTGAATAAGAGTGATGAGAA GGG Intergenic
No off target data available for this crispr