ID: 983363168

View in Genome Browser
Species Human (GRCh38)
Location 4:166753540-166753562
Sequence TAGTAATAGTTCAGTAATTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 239}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983363168_983363171 26 Left 983363168 4:166753540-166753562 CCCTAATTACTGAACTATTACTA 0: 1
1: 0
2: 1
3: 22
4: 239
Right 983363171 4:166753589-166753611 AACTACCCCATATAATGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983363168 Original CRISPR TAGTAATAGTTCAGTAATTA GGG (reversed) Intronic
904843559 1:33390548-33390570 TAGTAATTGTTCAATAAATATGG - Intronic
908087463 1:60651507-60651529 TTGTAATAGTTTATTAATTAGGG - Intergenic
908687146 1:66734318-66734340 AAGAAATAGTTCAATAATAAAGG + Intronic
910621849 1:89263982-89264004 TAGCAATACTTCAGTATTTCTGG + Intronic
910644736 1:89501460-89501482 TAGTAAGAATTAAGGAATTAAGG - Intergenic
912992142 1:114498792-114498814 TAGTAATAGTTCAATAAGAGTGG + Intronic
913356932 1:117932190-117932212 TAATAAAAGTGCAGAAATTATGG + Intronic
914353498 1:146860849-146860871 TATTAAAAGTACAATAATTAAGG + Intergenic
917063094 1:171062314-171062336 TAGTAGTAGTTGGATAATTACGG + Intronic
917317722 1:173743492-173743514 TAGTAAGTGTTCAGGAATAAAGG - Intronic
918600675 1:186355957-186355979 TAGAGATAATTCAGTATTTATGG + Intronic
920249081 1:204610528-204610550 TAGTAATAGCTCAGTAAGTTAGG - Intergenic
921769647 1:219021482-219021504 GAGGAAAAGTTCAGTAATTTTGG + Intergenic
923825572 1:237496037-237496059 TAATAATTTTTTAGTAATTAAGG + Intronic
1067112717 10:43411652-43411674 TAGTAATGCTTCAGAAATTAGGG + Intergenic
1068960000 10:62858085-62858107 TAGTAATAATGCACTAATAATGG - Intronic
1069964357 10:72101793-72101815 TGGTAGTAGTTCAGTCATGAGGG + Intronic
1071462842 10:85914801-85914823 TAGAAATTGATCAGTAATTTAGG + Intronic
1071903097 10:90141634-90141656 TAGTAAATGTTCAGTAAATAAGG + Intergenic
1072439250 10:95439291-95439313 TAGGAAGAGTTCAGAAATTCTGG - Intronic
1073172871 10:101527059-101527081 TAGTAATAGTTCACAAATAAAGG + Intronic
1073552791 10:104418689-104418711 AAGTAATTATTCAGTTATTAAGG + Intronic
1074973204 10:118559298-118559320 TAATAATAGCTCAGGATTTAGGG - Intergenic
1075922778 10:126226688-126226710 TAGTAAGTGTTCAGTAATTGAGG + Intronic
1075922779 10:126226718-126226740 TAGTAAATGTTCAGTAATTGAGG + Intronic
1078481222 11:11677436-11677458 AACCAATAGTTCAGTGATTAGGG - Intergenic
1078791977 11:14552783-14552805 TAATAAAACTTCATTAATTAGGG - Intronic
1079115782 11:17639777-17639799 TGGTGATAGTGCAGTGATTATGG + Intronic
1079841180 11:25401231-25401253 TAGTAATAATTTAGATATTATGG - Intergenic
1080169812 11:29287063-29287085 TAGTAATAGCTAAAAAATTAAGG + Intergenic
1081592233 11:44432096-44432118 TTGTAATTGGTAAGTAATTATGG + Intergenic
1082188854 11:49217179-49217201 TAGCAATGGTTCAGTAATCTAGG - Intergenic
1085655546 11:78311212-78311234 TAATAAGTGTTCAGTAAATATGG - Intronic
1086361577 11:86065830-86065852 TATTAATAATTCATGAATTATGG - Intronic
1086436603 11:86787241-86787263 AAGTAATAGCTCAGTAATGAAGG - Intergenic
1086804545 11:91224081-91224103 TAGGAATAGTTTTGAAATTATGG + Intergenic
1087335269 11:96836198-96836220 TAGTAAGTGTTCATTAAATATGG - Intergenic
1089151464 11:116367531-116367553 TAATATTATTTCTGTAATTATGG + Intergenic
1089950552 11:122521576-122521598 TGGAAATACTTCAGTCATTAGGG + Intergenic
1093203071 12:16213251-16213273 TAGTAAGTGTTCAGTAAAGATGG - Intronic
1093637755 12:21492156-21492178 AAGTAATAGCAAAGTAATTAGGG - Intronic
1093905188 12:24682778-24682800 TAGAAATAGTTCAGTTTTTTTGG + Intergenic
1094279381 12:28718508-28718530 TATTAGTAGTTAAGTATTTAGGG + Intergenic
1094596199 12:31869002-31869024 TAGCTATGATTCAGTAATTATGG + Intergenic
1094640607 12:32271424-32271446 TAACAAAAGGTCAGTAATTAAGG - Intronic
1097498121 12:60368711-60368733 GAGTATTGGTTCAGTCATTATGG + Intergenic
1097513390 12:60571595-60571617 CAATAAAAGTACAGTAATTAAGG + Intergenic
1099113347 12:78591145-78591167 AAGTAATTGTTTAGTTATTAAGG - Intergenic
1099133859 12:78868198-78868220 TGGTAATAATTAAGTAATTTGGG + Intronic
1099976861 12:89555215-89555237 TAGTAATGGGTGTGTAATTATGG - Intergenic
1099986723 12:89674271-89674293 TATTCATAGTTCAGTAAAAAAGG + Intronic
1100975911 12:100122480-100122502 TAGTAAATGCTCAGTAAATATGG - Intronic
1103309699 12:119994913-119994935 GAGTACTGGTTCAATAATTATGG - Intronic
1104603970 12:130174188-130174210 TAAAAATAATACAGTAATTAGGG + Intergenic
1105754268 13:23450748-23450770 GTGTAATAGTTCAGTTATTATGG - Intergenic
1105794886 13:23841682-23841704 TAGTTATAAGTCAGTAATTAAGG + Intronic
1106610988 13:31280395-31280417 TAGAAATACTTCAGTAACAAAGG + Intronic
1107001597 13:35552702-35552724 TAGTAATCTTTCAGGAATCATGG - Intronic
1108893748 13:55296059-55296081 TAGTAATCATTCAGTAAATATGG + Intergenic
1109460398 13:62649011-62649033 TAATAATCGTTCAATAATTTTGG - Intergenic
1109935729 13:69281432-69281454 TAGTGACAGTTCAGTATTCATGG + Intergenic
1110216405 13:73029433-73029455 TAGTTTTACTTCAGTAATTGAGG - Intergenic
1110770605 13:79339597-79339619 TAGTAATAGAACAGTATATACGG + Intronic
1111196663 13:84883374-84883396 TAGTCATCGCTCAGTATTTATGG + Intergenic
1111197969 13:84898369-84898391 GAGTGATAGTTCAGTATCTAGGG + Intergenic
1111578692 13:90193929-90193951 TAATATTAGTTCAGTAATTATGG - Intergenic
1112957661 13:105081197-105081219 TATGAATAGTTCAGTCATTGTGG - Intergenic
1113033331 13:106018662-106018684 TGGTAACAGTTCAGTAATGCTGG + Intergenic
1113904310 13:113812200-113812222 TAATAATAGCTAATTAATTAAGG - Exonic
1116348850 14:43833052-43833074 TATAATTAGTTCAGTCATTATGG - Intergenic
1116478411 14:45367869-45367891 TGGTAATAATTGAGTAATTAAGG + Intergenic
1116599032 14:46895055-46895077 TAGTAATAAATTAATAATTAGGG + Intronic
1117127537 14:52646419-52646441 TAGAAATATTTCAAGAATTATGG - Exonic
1117593173 14:57297833-57297855 TAGTGATGTTTGAGTAATTAGGG + Exonic
1117929698 14:60828208-60828230 TTTTAAGAGTTGAGTAATTAAGG - Intronic
1120581114 14:86250564-86250586 TAGAACTAGTTTAGTAATTTGGG + Intergenic
1124856796 15:33396974-33396996 TATTAATACTTCTGTAATAAAGG + Intronic
1126540901 15:49822202-49822224 TAATCATATTTCAGTAAATATGG - Intergenic
1126566433 15:50105358-50105380 TAGTAATAATTGTATAATTAAGG + Intronic
1127405421 15:58639610-58639632 TATTAATAGTGCAGTACTTTTGG - Intronic
1132756823 16:1489385-1489407 TAATAATAATTAATTAATTAAGG - Intergenic
1133383631 16:5351381-5351403 TTGGAATAGTTAAGTGATTAGGG + Intergenic
1134425768 16:14142607-14142629 TAGTCATGTTTCAGTAAATATGG - Intronic
1137910739 16:52375405-52375427 TAGTAAAGTTTCAGTAATTTGGG + Intergenic
1139095520 16:63700374-63700396 TAATAATTGTTTAGTAACTAAGG + Intergenic
1139526086 16:67517733-67517755 TAATAATAATTAATTAATTAAGG + Intergenic
1139727744 16:68915228-68915250 TAGTCCTAGTTGAGTAATTTAGG + Intronic
1139980524 16:70854669-70854691 TATTAAAAGTACAATAATTAAGG - Intronic
1140162311 16:72510244-72510266 TAGTAATTATTCAGGAATGAGGG + Intergenic
1144319239 17:14097718-14097740 TATTGACAGTTCAGTGATTATGG + Intronic
1145278428 17:21450954-21450976 TATTAATGGTAGAGTAATTAAGG + Intergenic
1146514205 17:33476320-33476342 TAGCTCTATTTCAGTAATTATGG + Intronic
1150853985 17:68733019-68733041 AGTTAATAGTTCAGGAATTAGGG + Intergenic
1150998564 17:70347626-70347648 TAGCATTAGTTCATTAATGAAGG + Intergenic
1151094674 17:71482858-71482880 CAATAAATGTTCAGTAATTATGG + Intergenic
1152780039 17:82223165-82223187 TAATAATAATTAATTAATTAAGG - Intergenic
1153171443 18:2320519-2320541 TAGTAAAATTCAAGTAATTATGG + Intergenic
1153365361 18:4249541-4249563 CAGTAACCGTTCAGTAATGATGG + Intronic
1153467740 18:5408038-5408060 TAGAAATAGTTCAGGAAGTGGGG + Intronic
1153537955 18:6123127-6123149 TAGCAATAGTTTTGCAATTATGG + Intronic
1154227426 18:12518911-12518933 AATTAATATTTCAGAAATTAGGG + Intronic
1155037197 18:22034780-22034802 TAATAATAATTCATTCATTATGG + Intergenic
1156286873 18:35705480-35705502 TAATAATAGCTCAGTTAATATGG + Intronic
1156820507 18:41366706-41366728 TAGTAATTTTTCTGTGATTATGG - Intergenic
1157111554 18:44825210-44825232 TAATAAAAATTCAGCAATTAGGG + Intronic
1158040334 18:53085572-53085594 AAGTAATATTTCAGCAATTCAGG - Intronic
1158196195 18:54887366-54887388 TAGTAAGTATTCAGTAAATACGG - Intronic
1158971243 18:62668622-62668644 TTGTAATAGTTCAATAAATGTGG + Intergenic
1159005936 18:63011598-63011620 AAGAAATTGTACAGTAATTAAGG - Intergenic
1159570702 18:70109327-70109349 TATTAATAGTTAAGTAAGGAAGG - Intronic
1159982270 18:74797848-74797870 TAGCCATATTTCATTAATTAAGG + Intronic
925191685 2:1889975-1889997 TGCTAATAGTTCAAGAATTAGGG + Intronic
926257183 2:11215869-11215891 TAATGATAGTTCAGTAATTGTGG - Intronic
926421946 2:12708452-12708474 TATTAATAGTTCTGTCATTCTGG - Intergenic
926837061 2:17034769-17034791 TAGTAAGAGATCAATAAATATGG + Intergenic
930443661 2:51442599-51442621 TAGTTATATTTCAGTACTTTTGG + Intergenic
930525456 2:52524258-52524280 TAGTCAGAGTTCAGTAGTTAAGG + Intergenic
930694845 2:54400962-54400984 TAGGGATGGTTCAGTAATGAGGG - Intergenic
932954977 2:76341082-76341104 TATTATTAGTTCAGTTTTTAGGG - Intergenic
933110974 2:78399591-78399613 TAGTAATAGTTTTATAATTGAGG - Intergenic
933209349 2:79549048-79549070 TAGTAATACTTCAGAAACTCAGG + Intronic
941170349 2:162128413-162128435 TACTAATTGTTCAGTAAAAAGGG - Intergenic
941183843 2:162296009-162296031 TAGTATTTTTTCAGTAATTTTGG - Intronic
941483093 2:166042723-166042745 TACTATTAGTTCAGAAATAAGGG - Intronic
942827781 2:180200765-180200787 AAGTAAAATTTCAGTAATTGTGG - Intergenic
943354901 2:186841271-186841293 TAGTAATATTTCTATAATTTTGG - Intronic
943417019 2:187620137-187620159 TAGTAATAGTACAATAAATTTGG + Intergenic
943494554 2:188605229-188605251 TAATATTAGTTCATTAATTGTGG + Intergenic
948084946 2:235239594-235239616 TAGTGATATTTCAGGAATAAGGG + Intergenic
1170440148 20:16371139-16371161 TAGTATTAATTCAGGAATTCAGG - Intronic
1170987088 20:21268401-21268423 TAGTAATAGTGTAATAAATAAGG - Intergenic
1173902889 20:46604038-46604060 TAGCAAATGTTCAGTAAATATGG + Intronic
1174512471 20:51064350-51064372 TGGTAACAGTACAGTAATTCTGG - Intergenic
1174877057 20:54238126-54238148 GAGTCATAGTTCAGCATTTATGG + Intergenic
1174976825 20:55345078-55345100 TATTAATAGTTGAATATTTAAGG - Intergenic
1176677868 21:9797580-9797602 CATTAATAATTCAGAAATTAGGG - Intergenic
1177228111 21:18283571-18283593 TATTAATAGTTCATTAATATAGG - Intronic
1178069837 21:28952078-28952100 TAGAAATTATTCATTAATTAGGG + Intronic
1180685496 22:17663260-17663282 TAGTAAGAATTCAGAAATGATGG + Intronic
949575772 3:5338056-5338078 TAGTAGTTGCTCAGTAAGTATGG + Intergenic
951161773 3:19431533-19431555 TTGGAATAGTTCAGTAGTAATGG + Intronic
956389000 3:68751757-68751779 TAGTAATATTTCTATGATTATGG + Intronic
956987559 3:74719812-74719834 TAGAAATAGTTAAATAATAATGG - Intergenic
958500715 3:94904898-94904920 TTGTTATAGTTCAGTACGTAAGG - Intergenic
958692747 3:97489043-97489065 TAGTTATCGTTCAGAAATTTGGG + Intronic
958715392 3:97774298-97774320 TAGTTATAGTTTAGTTATTCCGG + Intronic
960021451 3:112959142-112959164 TAGTAATAGTTACCGAATTAGGG - Intronic
960379782 3:116945837-116945859 AAGTAAAACTTCAGTAATTTAGG + Intronic
960720149 3:120617666-120617688 AAGAAATAGCTGAGTAATTAGGG - Intergenic
963298621 3:143574751-143574773 TAATAATGGTTCATTAATAATGG - Intronic
963796792 3:149638804-149638826 TAATCAAAGTTCAGGAATTATGG + Intronic
964055203 3:152447112-152447134 TATTTATAGTTCAGTATTTAAGG + Intronic
964072819 3:152655395-152655417 TAGTAATAGTTAATTATTTTAGG + Intergenic
964195835 3:154063180-154063202 TAGAAATAGTTCATTGATTGAGG + Intergenic
964690712 3:159446692-159446714 AACCAATAGTTCAGTGATTAGGG + Intronic
964789460 3:160438994-160439016 CAGTAATACTTCTGCAATTAGGG + Exonic
965184768 3:165448612-165448634 TAGTAATCGTTCTGTAAATTTGG - Intergenic
965715441 3:171597586-171597608 TAGTAATATTTTAGGATTTATGG + Intergenic
965898306 3:173606074-173606096 TAATAATTGCTCAATAATTATGG - Intronic
965963605 3:174458173-174458195 TATTAATAGTTCACTATATAAGG + Intronic
967829695 3:193908634-193908656 TAGTAATAGGTGAGTAAGTCAGG + Intergenic
970910161 4:21265542-21265564 CAGTGATAGTTCATTATTTAAGG - Intronic
970958062 4:21837991-21838013 TTGTAATAATTCATTATTTATGG - Intronic
973737335 4:53885531-53885553 TAGTAATGGTTCAATAAACAAGG + Intronic
974341584 4:60620440-60620462 TAGTAATTTTTGAGTAATTATGG + Intergenic
974710392 4:65586095-65586117 TTAAAATAGTTCAATAATTAAGG - Intronic
976121939 4:81792702-81792724 TAGTAAGAGTATAGCAATTAAGG - Intronic
977158561 4:93605571-93605593 TAGTAATAGTTGAATGAATAGGG + Intronic
977963317 4:103110718-103110740 TGGTAACACTTCAGTCATTATGG - Intronic
978529351 4:109698630-109698652 GAGTAACAGTTCTGTGATTACGG + Intronic
978728109 4:111994467-111994489 ATTTAATAGTTCAGTAGTTATGG - Intergenic
980250075 4:130303735-130303757 TAGTAATAATCCATTAGTTAGGG - Intergenic
980483384 4:133420122-133420144 TATTAATAATTCAGAAATAAAGG - Intergenic
981811115 4:148775893-148775915 TAGCAATACCTCAGTAATTTTGG + Intergenic
982912952 4:161168008-161168030 TAGTAATATTTGTGAAATTATGG - Intergenic
983279057 4:165657346-165657368 TATTAAAACTCCAGTAATTAGGG + Intergenic
983363168 4:166753540-166753562 TAGTAATAGTTCAGTAATTAGGG - Intronic
983497939 4:168465082-168465104 TTGAATTAATTCAGTAATTATGG - Intronic
983613276 4:169673749-169673771 TATTAATATTTCAGGAATTGGGG - Intronic
983815114 4:172115652-172115674 TATTAATCTTTGAGTAATTACGG + Intronic
985397656 4:189561209-189561231 CAGTAATAATTCAGAAATTAAGG + Intergenic
987624393 5:20378837-20378859 TAGTAAAAATTCAGTAACAAAGG + Intronic
989436552 5:41420002-41420024 TAAAAATAGATGAGTAATTATGG - Intronic
989561277 5:42854722-42854744 TAATGAAGGTTCAGTAATTATGG - Intronic
991176594 5:63695421-63695443 TATTAACAGTCTAGTAATTATGG + Intergenic
991241042 5:64459966-64459988 TAGTAAAAGTTCAATAAATATGG - Intergenic
991634533 5:68691100-68691122 TTGTAAAACTTCAGTGATTATGG - Intergenic
993040247 5:82806088-82806110 TATTAATAGTTAAAAAATTAAGG - Intergenic
994200344 5:96967591-96967613 TAGTAGTATTTCAGTGACTATGG - Intronic
994543596 5:101132307-101132329 TATTAAAAGTACAGAAATTAGGG - Intergenic
994959636 5:106582440-106582462 CAGTTTTAATTCAGTAATTATGG + Intergenic
997940306 5:138151611-138151633 TTCTAATACTTCAGTCATTAGGG - Intronic
1000134966 5:158338869-158338891 AAGTAATAGTGAAGTAATAATGG - Intergenic
1000661484 5:163944556-163944578 GAATAGTAGTTCAGTAAGTAAGG - Intergenic
1000706871 5:164523466-164523488 TAGTAATATTTAAGTGATCAGGG + Intergenic
1000945060 5:167412247-167412269 TAGTAATGGTTCAGAAAGTGGGG + Intronic
1004101206 6:12613670-12613692 TATTAATAATTCTGTAATTCTGG + Intergenic
1005221424 6:23593007-23593029 TAGTAATAGTTTTTTAATTTGGG + Intergenic
1008437234 6:51490555-51490577 TAGAAAAAATTCAGTAAGTAAGG - Intergenic
1008713792 6:54263316-54263338 TATAAAACGTTCAGTAATTAAGG - Intronic
1009788220 6:68365643-68365665 TAGTAATAGTCCAGTTAGAATGG - Intergenic
1011037541 6:82994254-82994276 TGGTAATATTTCTGTAAGTAGGG - Intronic
1012087572 6:94850163-94850185 TAGTAAAAGTTCAGCAAATTCGG + Intergenic
1013262193 6:108455491-108455513 TAATGAAAGTTCAGAAATTAAGG - Intronic
1014853322 6:126368351-126368373 CAGTAAAGGTTCTGTAATTAAGG + Intergenic
1014902263 6:126981823-126981845 TAATAAGAGTTCAGCAATTTTGG + Intergenic
1015733538 6:136372917-136372939 TAGAAGTAATCCAGTAATTATGG + Intronic
1016991325 6:149931247-149931269 TAGTACTAGTTCAGCCACTATGG + Intergenic
1020403898 7:7809351-7809373 AATTCATAGTTCAGTAATTTAGG + Intronic
1022406373 7:30094028-30094050 TAGTACTAGTTAAGTTATGATGG + Intronic
1023436177 7:40142845-40142867 AAGGAATAGCTGAGTAATTAGGG - Intronic
1024128421 7:46324990-46325012 TACAAATAATTCAGTAATTTGGG - Intergenic
1026436028 7:70399679-70399701 TATTCATAGTTCAGCAATGAAGG + Intronic
1027540748 7:79461793-79461815 TACTAAGAGTTCAGTAGATAAGG - Intergenic
1027559695 7:79712916-79712938 TAGAAATAGTTCAGCTTTTAAGG + Intergenic
1027652998 7:80894324-80894346 TATTAATAATTCAGTTATTAGGG - Intronic
1028416358 7:90584572-90584594 TAGATTTAGTACAGTAATTAGGG - Intronic
1030520305 7:110590094-110590116 TAGTACTGGTTCAGTCACTAAGG - Intergenic
1030525307 7:110646072-110646094 TAGTAACAGTTCTGTAGTTCTGG + Intergenic
1031186444 7:118486196-118486218 TAGAAATAGTTCAGTTCTTCAGG + Intergenic
1031432929 7:121695254-121695276 TAGCAATTGTTCAGGAAGTATGG - Intergenic
1031470951 7:122168792-122168814 TTGTGATAGTTCAGAAATAAAGG + Intergenic
1032293734 7:130615396-130615418 TAATAGGAGCTCAGTAATTATGG + Intronic
1032570211 7:132988084-132988106 TATTACTAGTTCAGTTTTTAGGG + Intronic
1033821695 7:145142233-145142255 GAGTAACAGTTTAGTAACTAAGG - Intergenic
1035215878 7:157366249-157366271 TAGAAATATTTAAGTATTTACGG - Intronic
1035218211 7:157387223-157387245 TAGCAACAGTTAAGTAATTGGGG + Intronic
1038717414 8:30004303-30004325 TAGTCATAGTTCAGGATGTAAGG + Intergenic
1043215879 8:77587028-77587050 TATGCATAGTTCAGTAACTAAGG - Intergenic
1043608805 8:82035950-82035972 TAGTAAGAGCTCAATAAATATGG - Intergenic
1043705846 8:83349574-83349596 TAGTAATAATATAATAATTAAGG - Intergenic
1046348655 8:112973796-112973818 TACTACTAGTTCAGTGATTTTGG - Intronic
1049145620 8:140999918-140999940 TAGTAATATTGTAGTAATTATGG - Intronic
1050001165 9:1078162-1078184 AAGTAGAAGTTCAGAAATTAGGG - Intergenic
1054828132 9:69593910-69593932 AAGTAAAAGTTGAGTAATCAAGG - Intronic
1056085028 9:83139372-83139394 TATTAATAGTTAAGTTTTTAGGG - Intergenic
1056174494 9:84020790-84020812 TAGTAGTAGTTCATTCATGAAGG + Intergenic
1056505490 9:87254300-87254322 TAGTAAACGTTCAGTAAACAGGG - Intergenic
1058034817 9:100239288-100239310 TGGTAATAGTTCAATTATTGAGG - Intronic
1203663016 Un_KI270754v1:72-94 CATTAATAATTCAGAAATTAGGG - Intergenic
1186570626 X:10711518-10711540 TAGGAACAGTTCAGGAATTCTGG + Intronic
1188321728 X:28746873-28746895 TAAAATTAGGTCAGTAATTAGGG - Intronic
1188344648 X:29048960-29048982 TAGTATTTGTTCAGTAAGTATGG + Intronic
1190048525 X:47131953-47131975 TAGTATTATTTCAGTAGTTTTGG + Intergenic
1191913000 X:66171743-66171765 TAGTAAAAGTTCAATAAATGTGG - Intronic
1196230854 X:113219367-113219389 TATTAGTAGTTCAGTTTTTAGGG + Intergenic
1196281652 X:113829603-113829625 TAGTTATATTTCAGTAAGTTAGG - Intergenic
1197308243 X:124870456-124870478 TATTAAGAGTTCAGGGATTATGG + Intronic
1197801943 X:130359590-130359612 TATTAATATTACAATAATTAGGG - Intronic
1198139424 X:133787936-133787958 CAATAATAGGTCAGTGATTAAGG + Intronic
1200771373 Y:7128629-7128651 GAGTACTACTTCAGTAATAAAGG + Intergenic
1200777013 Y:7178476-7178498 AAGGAATAGTTGAGCAATTAGGG - Intergenic
1201953596 Y:19594651-19594673 TAAAAATAGTACAGTGATTATGG - Intergenic
1202278770 Y:23154458-23154480 TAGTAATACTTCAATAGTTTTGG - Intronic
1202285666 Y:23242371-23242393 TAGTAATACTTCAATAGTTTTGG + Intronic
1202285969 Y:23247151-23247173 TAGTAATACTTCAATAGTTTTGG + Intronic
1202286434 Y:23254306-23254328 TAGTAATACTTCAATAGTTTTGG + Intronic
1202431594 Y:24785798-24785820 TAGTAATACTTCAATAGTTTTGG - Intronic
1202431897 Y:24790555-24790577 TAGTAATACTTCAATAGTTTTGG - Intronic
1202432200 Y:24795311-24795333 TAGTAATACTTCAATAGTTTTGG - Intronic
1202437766 Y:24862827-24862849 TAGTAATACTTCAATAGTTTTGG + Intronic
1202438068 Y:24867607-24867629 TAGTAATACTTCAATAGTTTTGG + Intronic
1202438371 Y:24872364-24872386 TAGTAATACTTCAATAGTTTTGG + Intronic