ID: 983365750

View in Genome Browser
Species Human (GRCh38)
Location 4:166786189-166786211
Sequence TCTTCCCCCAGGTATCTGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 512
Summary {0: 1, 1: 1, 2: 15, 3: 101, 4: 394}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983365750_983365753 11 Left 983365750 4:166786189-166786211 CCATACAGATACCTGGGGGAAGA 0: 1
1: 1
2: 15
3: 101
4: 394
Right 983365753 4:166786223-166786245 CAAGTAAAAGACAAATATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983365750 Original CRISPR TCTTCCCCCAGGTATCTGTA TGG (reversed) Intronic
900776325 1:4588222-4588244 GCCTTCCCCATGTATCTGTAAGG - Intergenic
901336849 1:8456781-8456803 TCTTCCCCTATGTATCTGCAAGG + Intronic
902245726 1:15119213-15119235 TCTTCCCCCAGATCTTTGCAGGG - Intergenic
902569873 1:17340480-17340502 CCTTCCCCTAGGTGTCTGTCTGG - Intronic
902959933 1:19956121-19956143 TCTTCACCCAGATATCTGTGTGG + Intergenic
902983020 1:20139145-20139167 TCTTTCCCCATGCATCTGAAAGG - Intergenic
903024712 1:20419101-20419123 TCTTCCTCCAGGTATCTTTGGGG - Intergenic
903853696 1:26322996-26323018 TCTTCCCTCAGATATCTGCATGG + Intronic
904195452 1:28782045-28782067 TCTTCCCTCATATATCTGCAAGG + Intergenic
904401181 1:30257729-30257751 TCTTTCCTCAGGTAGCTGTGAGG + Intergenic
904819103 1:33229029-33229051 TTTTCCTCGAGGTATCTGTAGGG + Intergenic
906187621 1:43872901-43872923 TCTTCCCCAAGATATCAGCATGG - Intronic
906611446 1:47206566-47206588 TCTTTCCCCAAATATCTGCATGG + Intergenic
907486863 1:54784108-54784130 TCTTCTCCCAGATATCTGATTGG - Intronic
907755878 1:57310298-57310320 TCTTCCCCCAGATCTCTGCATGG - Intronic
907809607 1:57855590-57855612 TTTGCCCCCAGGTATTGGTATGG - Intronic
907829934 1:58055342-58055364 TCATCCCCCAGGTATCAGAATGG + Intronic
907905477 1:58781112-58781134 TCCTCCCCCAGCTATCTATATGG - Exonic
908109171 1:60877721-60877743 TCTTCTTCCAGTAATCTGTATGG + Intronic
908152901 1:61322544-61322566 TCTACCCCCACGTACCTGAAAGG - Intronic
908211276 1:61902906-61902928 TCTTCCTCCATATATCTATATGG - Intronic
908289492 1:62649871-62649893 TCTTCCCCCAGATATTTACAGGG + Intronic
908493447 1:64669897-64669919 TTTTCACCGAGGTAGCTGTAGGG + Intronic
908569798 1:65397286-65397308 ACTTCCCCCGGGTTTCTGCAAGG + Intronic
908623296 1:66009673-66009695 ACTTTCTCCAGATATCTGTATGG + Intronic
908843901 1:68305200-68305222 TCTTCCCTCAGATATTTGCATGG + Intergenic
908874794 1:68660871-68660893 TCTTCTGCCAGGTTTCTATAAGG - Intergenic
908939475 1:69414067-69414089 TCTTCCCCTAGGTATCTGACAGG + Intergenic
910438996 1:87233066-87233088 TCTTCTCCGAGGTATCTGCTTGG + Intergenic
911064908 1:93779582-93779604 CCTTCCCCTAGGTATCTGCATGG - Intronic
912210065 1:107547461-107547483 TCTTCCCCCAAGTATCCCCATGG - Intergenic
912565790 1:110586274-110586296 TCTTCTCACATGAATCTGTATGG + Intergenic
912635689 1:111290500-111290522 CCCTTCCCCATGTATCTGTAAGG + Intergenic
912801106 1:112720198-112720220 TCTTCCAGCAGGAATCTGTCAGG + Intergenic
912811046 1:112794796-112794818 ACTACCCCCAGCTATCTGCAAGG + Intergenic
912877802 1:113379911-113379933 TCTTCCCCCAGATATCTGCATGG - Intergenic
913229806 1:116732314-116732336 TCTTCCACCAGATAGCTGCACGG + Intergenic
913376512 1:118158378-118158400 TCTTCCCCTAGTCCTCTGTATGG - Intronic
914349685 1:146830290-146830312 TCTTCACACAGGCATCTGTGTGG - Intergenic
914570663 1:148913316-148913338 TCTTCCCCCAGTTCTCTGTTTGG - Intronic
914602168 1:149216953-149216975 TCTTCCCCCAGTTCTCTGTTTGG + Intergenic
915242986 1:154537098-154537120 TCTTCTCCCAGGTGTCTATAGGG + Intronic
915363120 1:155297859-155297881 TCTTCCCCCAGGTCTCTGCATGG + Intronic
915594638 1:156889199-156889221 TCTTCCCCCAGAAATCTCCATGG + Intergenic
915729089 1:158040273-158040295 TCTTTCCCCAGTTAGATGTATGG - Intronic
915806473 1:158858791-158858813 TGTTTCCCCAGTTATCTGTGAGG - Intergenic
916260532 1:162837550-162837572 TCTTCCTCCAGGCAGCAGTAGGG - Intronic
916486743 1:165266290-165266312 TCTTCCCACAGATATTGGTAAGG - Intronic
916765730 1:167858629-167858651 TCTTCCACCAGGCTTCTGTAAGG - Intronic
916779980 1:168014794-168014816 TCTTCCTCCAGGTATCCATGTGG + Intronic
917067632 1:171113999-171114021 TCTTTCCTCAGGACTCTGTATGG - Exonic
917160830 1:172055293-172055315 TCTGCCCCAAGATATCTGCATGG + Intronic
918155488 1:181841911-181841933 TCTGCCCCCAGCTATGTTTAAGG + Intergenic
918214766 1:182384039-182384061 TCTTCTTCCAGGTAGCTGAAAGG - Exonic
920751559 1:208682846-208682868 ACTTCCCCCAGGGATGTGTGGGG + Intergenic
920867131 1:209762556-209762578 TCCTCCCTCAGGCATCTGCAGGG + Exonic
921031296 1:211337293-211337315 TCTTCACCCTGATATCTGAAGGG - Intronic
922014566 1:221632258-221632280 TCTACCACCAGCTATCTGTATGG + Intergenic
923201170 1:231712952-231712974 TCTTGCCCCAAGTATATGCATGG - Intronic
924449548 1:244165212-244165234 TCTTTCCCCAGGAATTTGTGTGG - Intergenic
1064931775 10:20636706-20636728 CCTTCCCCCAGGTATTGGCATGG - Intergenic
1065141963 10:22726702-22726724 TCTTCCCACAGGTACCTGGATGG - Intergenic
1065309070 10:24396637-24396659 TCTTCCCCCAGATATCTGCATGG - Intronic
1065867580 10:29927251-29927273 TCTTCCCTCAGATCTCTGTCAGG + Intergenic
1069987768 10:72295973-72295995 CCTTGCCCCTGGTATCTGTGTGG + Intergenic
1071930347 10:90462722-90462744 TATTTCCCCAGATATCTGCAAGG - Intergenic
1073324906 10:102636985-102637007 TCTTCCCCCAGATAGCCCTATGG - Intergenic
1073451647 10:103613176-103613198 TCTTTGCCCAGGTATCTGTGGGG + Exonic
1074096749 10:110319955-110319977 TCTTCCACCAGGTATCCACATGG - Intergenic
1074266103 10:111904977-111904999 TCTTCAGCCAGGTAGCTGGATGG + Intergenic
1074622659 10:115142279-115142301 TCTTCCCCTAGATATCTATATGG - Intronic
1075281451 10:121142339-121142361 TCTTCCCCCAGATATTTGCTAGG - Intergenic
1075754377 10:124799472-124799494 TCTTCTCCCAGGCAGCTGCATGG - Intergenic
1075894523 10:125983587-125983609 TCTTCCCCCAGATAGTTGCAAGG - Intronic
1076015753 10:127026443-127026465 TCTTCCCCCAAGTATTTTTAAGG + Intronic
1076672687 10:132131788-132131810 TCTTCCCCCGGGTGTCTGTGTGG + Intronic
1078266938 11:9762082-9762104 TCTTCCCCCAGATATCTTCACGG - Intergenic
1078662455 11:13298328-13298350 TCTTCCCCCAGAGGTGTGTATGG + Intronic
1078968136 11:16371262-16371284 TCTTCCCCCAGATATCTGCATGG + Intronic
1078972601 11:16431076-16431098 TCTTCCACCAGATATCTGCTTGG + Intronic
1079819303 11:25105338-25105360 TCTGCCCCCATGGCTCTGTAGGG + Intergenic
1080044434 11:27794349-27794371 TCTTTCACCAGGTATCTATATGG - Intergenic
1080547592 11:33336218-33336240 TCTTCCCCTAGATATCTGTATGG - Intronic
1080941385 11:36922103-36922125 ACTTACCCCAGGTATCTGCTAGG - Intergenic
1081197348 11:40177561-40177583 TCTTCCCCCAGATAGCTATAGGG + Intronic
1081700893 11:45151987-45152009 TCTTACCCCAGTTATCTCCATGG + Intronic
1083287115 11:61667210-61667232 TCTTCACCCAGGAATCTTTCAGG + Intergenic
1083471490 11:62887289-62887311 ACTTCCCTCAGGTATCTGCTTGG - Intronic
1083579432 11:63815245-63815267 TCTTCCTGCAGATATCTGCAAGG - Intronic
1083984821 11:66206790-66206812 TCTTCCTCCAGATACCTGCATGG - Intronic
1084957876 11:72701108-72701130 CATTCCCCCAGGTATCTGCATGG - Intronic
1085774230 11:79351106-79351128 TTTTCCCGCAGGTATTTTTAAGG + Intronic
1087825023 11:102755264-102755286 TTTTCCCCCAGATATTTTTATGG - Intergenic
1087875015 11:103344547-103344569 TCATACCCTAGGTATCTGAATGG + Intronic
1089007875 11:115107748-115107770 TCTTCCTCCAGATACCTGCATGG - Intergenic
1092392009 12:8088875-8088897 TTTTCCCCCAGACATCTGTATGG + Intronic
1092860189 12:12713474-12713496 TCTTTCCCCAGATAGCTGTATGG + Intergenic
1093489510 12:19688816-19688838 TCATCCCCCAGATATCCATATGG + Intronic
1095054856 12:37586611-37586633 TCTTCCTCCATATACCTGTAAGG + Intergenic
1095979176 12:47961171-47961193 TCTACCCCCAGCCATCTGCATGG - Intergenic
1096724643 12:53551460-53551482 TCTTCCCCCAGGTTTTCTTAGGG + Intronic
1097937857 12:65273429-65273451 TCCTCTCCCAGGTATTTGAATGG + Intergenic
1099945081 12:89234848-89234870 TCTTCCCCCAGATATCTGCCTGG + Intergenic
1101520099 12:105474595-105474617 ACTTCCCCCAGATACCTGCATGG - Intergenic
1101743695 12:107521797-107521819 TCTTCCTCCAGGTATCCCCATGG + Intronic
1102683165 12:114704184-114704206 TCTGGCCCCAGGAATCTGTGTGG + Intergenic
1103011610 12:117462535-117462557 TGTTCCCCCTGAAATCTGTAAGG - Exonic
1103164163 12:118755972-118755994 TCTTCCCCCAGGTAGCCACATGG - Intergenic
1103816065 12:123657475-123657497 TCTTCCCGCAGGTGTTTGCATGG + Intronic
1104360742 12:128130389-128130411 TTTTCACCCAGGCATTTGTAAGG - Intergenic
1104407075 12:128526757-128526779 CTTTCCCCCAGGTATCTGCACGG - Intronic
1104695769 12:130862501-130862523 TCTTCCTCCAAATATCTGCATGG + Intergenic
1106740012 13:32630673-32630695 TCTTCCCTCAGGTATTTGCATGG + Intronic
1107268243 13:38583163-38583185 TCTTCTCTCAGGTATCTTCATGG - Intergenic
1107540192 13:41382173-41382195 TAATCCACCAGGGATCTGTAGGG + Intergenic
1107714794 13:43189447-43189469 TCTTCCCCCACACATCTGCATGG + Intergenic
1107747372 13:43524675-43524697 TCTTCCCCAAGATGTCTGCATGG + Intronic
1107913909 13:45129937-45129959 TCTTCCCATGGGTATCTGCAAGG - Intronic
1108303512 13:49106142-49106164 TCTTCCCTCAGATATCCATATGG + Intronic
1108390949 13:49947219-49947241 TCTTCCCCCAGCTGTCTGAATGG + Intergenic
1108401023 13:50043160-50043182 TCTTCTCCCAGGTACCTACATGG + Intergenic
1108461711 13:50673542-50673564 TCTTCCCCCAGACACCTGCAAGG + Intronic
1109584360 13:64378556-64378578 TCTCCACCCAGGTGTCTTTAGGG - Intergenic
1110523600 13:76509484-76509506 TCTTCCTCCAGGTGACTGCAGGG - Intergenic
1110637984 13:77788226-77788248 TCTTCCCCAAGGTCTTTGTGTGG + Intergenic
1110811202 13:79812192-79812214 TCTTCTCCCAGGTCTTTGCATGG + Intergenic
1111117737 13:83803077-83803099 TCTTCCCCCAAATAGCTGCAAGG - Intergenic
1112418559 13:99226814-99226836 CCTTCCCTCAGATATCTGCAAGG + Intronic
1112598780 13:100834142-100834164 TCTTCCCTCAGGCCTCTGGAGGG - Intergenic
1113247941 13:108419849-108419871 TTTTCCCCCAGATACCTGCAGGG - Intergenic
1114884950 14:26837465-26837487 TCTACCCCCGGGTAGCTTTATGG - Intergenic
1114948060 14:27711920-27711942 TATTCCCCCAGGTTTCTACATGG + Intergenic
1115075252 14:29381250-29381272 TCTCCGTACAGGTATCTGTAGGG + Intergenic
1115665779 14:35544194-35544216 TTTTCCCCCATATATCTTTAAGG - Intronic
1116119580 14:40705528-40705550 CCTTCCCCCAGGTCTCTCTTTGG + Intergenic
1116365122 14:44050649-44050671 TCTTCCTCCACATATCTGCATGG + Intergenic
1117063519 14:51986343-51986365 TCTTTCCCCAGATATTTGTGTGG + Intergenic
1118514220 14:66508584-66508606 TCCTCCCCCGGTTACCTGTAAGG - Exonic
1118834313 14:69465543-69465565 TCTCCTCCCAGGTATCTGCTTGG - Intergenic
1119313177 14:73668063-73668085 TCTTCCTCCAGATATGTGCATGG + Intronic
1119386144 14:74259066-74259088 ACTTCACCCAGGTATCAGGAAGG - Intronic
1120013648 14:79445655-79445677 TCTTCCCCCAGATGTTTGCATGG - Intronic
1120410178 14:84144550-84144572 TTTTCTCCCAGTTACCTGTAAGG + Intergenic
1122058581 14:99121717-99121739 CCTCCCCCCAGGTATCCGCAGGG + Intergenic
1122368848 14:101216233-101216255 TCTACCCCCAGGCATCTATGTGG + Intergenic
1123501187 15:20882603-20882625 TCTCTCCCCAGTTCTCTGTATGG + Intergenic
1123558439 15:21456308-21456330 TCTCTCCCCAGTTCTCTGTATGG + Intergenic
1123594670 15:21893583-21893605 TCTCTCCCCAGTTCTCTGTATGG + Intergenic
1124030469 15:26006197-26006219 TGTTTCCCCAGGTACCTGTGAGG + Intergenic
1124947647 15:34284890-34284912 TCTTCCTGCAGATATTTGTATGG - Intronic
1125012746 15:34898272-34898294 ACTTCCCTGAGGTATCTGTGGGG - Intronic
1125730653 15:41891010-41891032 TATTCTCCCAGGTATCTGCATGG + Intronic
1126774501 15:52088477-52088499 TCTTCTCCCAGATATCTGCTTGG + Intergenic
1127563065 15:60159665-60159687 TCCTCTCCCAGATATCTGTGTGG - Intergenic
1128427677 15:67558772-67558794 TCTTTCCCCAGATATCAGCAAGG + Intronic
1128505061 15:68262902-68262924 TGTTCCCCCAGCTCTCAGTATGG + Intergenic
1128597868 15:68968463-68968485 TTTTGCCCCAGGTTGCTGTATGG - Intronic
1130688164 15:86057209-86057231 TCTTTCCCCAGATGTCAGTAAGG + Intergenic
1130745359 15:86647896-86647918 TCTTCCACCAGATACCTGCATGG - Intronic
1131255789 15:90861038-90861060 TCTGACCCCAGGGATCAGTAAGG - Intergenic
1131290813 15:91105357-91105379 TCTTTCCCCAGATAACTGTCTGG - Intronic
1202966789 15_KI270727v1_random:183458-183480 TCTCTCCCCAGTTCTCTGTATGG + Intergenic
1133434530 16:5767649-5767671 TCTTCCCCTTGGTATTTATAGGG + Intergenic
1134769532 16:16795143-16795165 TCTTCCCACAGATATCTACATGG - Intergenic
1136451441 16:30356251-30356273 TCTTCCCCCAGGCAACTAGATGG + Intergenic
1137321872 16:47392325-47392347 TCTTCCCCCAGATATCCACAGGG - Intronic
1137869299 16:51934102-51934124 TCTGTCCCCAGATATCTTTATGG - Intergenic
1138050534 16:53772323-53772345 TCTTCCCCCAGGTATCTGCGTGG + Intronic
1138706764 16:58922914-58922936 CCTTCCCTCAGGTACATGTATGG - Intergenic
1139577061 16:67848104-67848126 TCTTCCCCCAGAACTCAGTAGGG - Intronic
1139984350 16:70885256-70885278 TCTTCACACAGGCATCTGTGTGG + Intronic
1140482589 16:75269883-75269905 TTTTCCCCCTGCTTTCTGTAGGG + Intergenic
1141255861 16:82401904-82401926 TCCTCCCCCAGATATCTGCAGGG - Intergenic
1141741156 16:85894025-85894047 TCATCTCCCTGGTAGCTGTAGGG - Intergenic
1143097703 17:4487274-4487296 TCTTTCCCCAGGTCGCTGAACGG - Intronic
1143328606 17:6118104-6118126 TCTGCCACCAGGGACCTGTATGG - Exonic
1143364813 17:6399900-6399922 TGCTTCCCCAGGTATCTGCATGG - Intronic
1143875908 17:9990581-9990603 TCTTCCCTCAGATATGTGTGTGG - Intronic
1145262699 17:21364334-21364356 TCTGCCCCCAGATCTCTGCATGG - Intergenic
1145375533 17:22344192-22344214 TCTTCCTCCATATACCTGTAAGG + Intergenic
1145841478 17:27998918-27998940 TCTTCCTCCAGATATCTGCATGG - Intergenic
1145959410 17:28878471-28878493 TCTTCCTTCAGATATCTGAATGG + Intergenic
1146127944 17:30243780-30243802 TCTTCCCTCAGGTCTTTGCATGG - Intergenic
1146805467 17:35861650-35861672 TCTTCTCTCAGATATCTGTAAGG + Intronic
1146903941 17:36606153-36606175 TCTTGCCCCAGATGTCTGCACGG + Intronic
1146962861 17:36999781-36999803 TCTTCCCCCAGACAACTGCATGG - Intronic
1147266266 17:39236725-39236747 TCTTCCCCCAGGAGTCTGGATGG - Intergenic
1147477252 17:40723931-40723953 TCTTCCCTCAGATACCTGCAGGG + Intergenic
1148651462 17:49253079-49253101 TCTTCCCCCAGGCACTTGTATGG - Intergenic
1148669847 17:49402418-49402440 TCATCCTCCAGGTGTCTGTAGGG - Intronic
1150295667 17:64006049-64006071 ACTGCCCCCAAGTATCTGCAGGG - Intronic
1150477651 17:65487164-65487186 TCTTCCACCAGGTATTCATATGG + Intergenic
1151523558 17:74648246-74648268 CCTTCCCCATGGGATCTGTAGGG - Intergenic
1151703032 17:75753487-75753509 ACTTCCCCCAGGTTTCTGGCGGG + Intronic
1153113132 18:1618557-1618579 TCTTCCCTCAGATATATGCATGG - Intergenic
1154325332 18:13387099-13387121 TCTTCCCCGAGGTGTCTGTGAGG + Intronic
1155045531 18:22100046-22100068 TCTGCCCCCAGGTAGCCATATGG - Intergenic
1155910026 18:31496408-31496430 GCCTTCCCCATGTATCTGTAGGG + Intergenic
1156202725 18:34852744-34852766 TCTTCCTCCAGGTCTCTGTGTGG + Intronic
1156310720 18:35919324-35919346 CCTTCCCCAAGATATCTGCAGGG - Intergenic
1156462030 18:37326553-37326575 TCTTCCTCCAGGTGCCTGAAGGG + Intronic
1157871879 18:51237477-51237499 TCTTCCCCCAGAAATCTGCCTGG + Intergenic
1158228701 18:55229344-55229366 TCTGCCCCCCTGTATCAGTATGG - Intronic
1158422586 18:57309049-57309071 TCTTCACCCAGATATCCGTATGG - Intergenic
1158707035 18:59801928-59801950 TCTTCTGCCAGGGATTTGTAAGG + Intergenic
1160512967 18:79462874-79462896 TCTTCCCTGAGGTTTCTGAAGGG - Intronic
1161533833 19:4806541-4806563 CCTTCCCCCAGGTACCTACATGG - Intergenic
1161752054 19:6105349-6105371 TCTTTGCCCAGGTATTTGGAGGG - Intronic
1162534507 19:11254831-11254853 TCTACCCTCAGGTAACTGCATGG - Intronic
1162850975 19:13430908-13430930 TCTTCCCCCAGATATCTGCTTGG - Intronic
1163066599 19:14801237-14801259 TTTTCCCCCTGCTATCTGCATGG + Intronic
1163720882 19:18897678-18897700 TGTTCCCCTAGGTACCTGCATGG + Intergenic
1163984986 19:20937808-20937830 TCTTCCTCCAGGACTCTGGAAGG + Intronic
1164001274 19:21101712-21101734 TCTTCCTCCAGGTCTCTGAAAGG + Intronic
1164008041 19:21169918-21169940 TCTTCCTCCAGGTCTCTGGAAGG + Intronic
1164014595 19:21242240-21242262 TCTTTCTCCAGGTCTCTGGAAGG - Intronic
1164027094 19:21362233-21362255 TCTGCCCCCTGGATTCTGTAAGG + Intronic
1164116356 19:22223059-22223081 TCTTCCTCCAGGCCTCTGGAAGG + Intergenic
1164141228 19:22466276-22466298 TCTTCCTCCAGGCCTCTGGAAGG + Intronic
1164224397 19:23229319-23229341 TCTTCCTCCAGGCCTCTGGAAGG - Intronic
1164239565 19:23372669-23372691 TCTTCCTCCAGGCCTCTGGAAGG - Intronic
1164253226 19:23503253-23503275 TCTTCCTCCAGGCCTCTGGAAGG - Intergenic
1164297195 19:23922451-23922473 TCTTCCTCCAGGCCTCTGGAAGG + Intronic
1164393910 19:27847511-27847533 GCCTTCCCCATGTATCTGTAAGG - Intergenic
1165286517 19:34847092-34847114 TCTTCCCTCACGTGTCTGTGTGG + Intergenic
1165294122 19:34912453-34912475 TCTTCCCTCAGATATCTGCGTGG - Intergenic
1166314283 19:41980122-41980144 TCTTCCCCCAGACACCTGCAGGG + Intronic
1166722829 19:45007116-45007138 TCTTCCCCCAGTTCTTTGCATGG - Intronic
1167144985 19:47676137-47676159 TCTTCCCCAAGGGGTCTGCAAGG - Intronic
1167148636 19:47696550-47696572 TGCTCCCCCAGGTCTCTGGAAGG - Intronic
1167704360 19:51070205-51070227 TCTTCCCCCAGATGTCTGCATGG + Intergenic
1168101218 19:54142172-54142194 TCTTCTCCCAGGTCTCTCTTGGG + Exonic
1168367062 19:55797339-55797361 TCTTTCCCCAGATAGCTGCATGG + Intronic
926355827 2:12039877-12039899 TCTTTCCCTAGGTCTCTGAAAGG - Intergenic
926821160 2:16853243-16853265 TCTTTCCCAAGGTGTCTGCAGGG + Intergenic
927072949 2:19548760-19548782 TCTGCCCACAGGTATCTCTGTGG - Intergenic
927678238 2:25122625-25122647 GCTTCCTCCAGGGATCTGCATGG + Intronic
928975237 2:37080036-37080058 TCTTCCCCTGGGTATCTGCATGG - Intronic
929346257 2:40888039-40888061 TCTTCATCCAAATATCTGTATGG - Intergenic
930039862 2:47113389-47113411 TCTTTGCCCAGTTATCTGTTGGG - Intronic
930376322 2:50571791-50571813 TTTTCCCCCAAGCATCTGAATGG - Intronic
931050848 2:58412730-58412752 TCTTTCCCCAGGTATATCAAAGG - Intergenic
931524051 2:63133242-63133264 TTTTGCCCCAGGAATCTGTAGGG + Intronic
931774898 2:65532136-65532158 TCTTCCCCCACTGAACTGTAGGG - Intergenic
931842403 2:66168215-66168237 TCTTCCTCCAGATATCTGCGTGG - Intergenic
932089344 2:68791037-68791059 TCTTTCCCCAGGTAGCTGCATGG + Intronic
932118506 2:69076832-69076854 TCTGCCCCCAGATCTCTGTGTGG - Intronic
932592153 2:73074048-73074070 GCTTCCCCAAGGCATCTGCAGGG - Exonic
932999103 2:76899512-76899534 TCTTCTCCCAGGCATCTGCAGGG - Intronic
933125924 2:78605700-78605722 TCTTTCCACAGCTATCTGGAAGG + Intergenic
936416386 2:112317870-112317892 TTTTCCCCCAAATATCTGTCAGG + Intronic
937486218 2:122317604-122317626 TCTTTCCTCAGATATCTGTGTGG - Intergenic
937842339 2:126536276-126536298 TCTTCCCCCAGATCTGTGCATGG - Intergenic
937976735 2:127586979-127587001 TCTTCCTGCAGGTGTCTGTGAGG - Intronic
938210127 2:129460072-129460094 CCTTCTCCCAGGTCTCTGTGAGG - Intergenic
938895551 2:135746631-135746653 TCTTCCCCCAGATAACTACATGG - Intronic
939010205 2:136837460-136837482 TCTTCCTCCAGATAGCTGCAAGG + Intronic
939574842 2:143883433-143883455 GCTTTCCCCAGATCTCTGTATGG + Intergenic
941915339 2:170809223-170809245 TCTTCCTCCAGGCATTTGTAGGG - Intergenic
942950284 2:181713497-181713519 ACTTCCCCCAGATTTCTGTGTGG - Intergenic
943343075 2:186704921-186704943 TTTGCCCCCATGTATATGTAAGG + Intronic
944138376 2:196426753-196426775 TCTTCCCCCAACAAGCTGTAGGG + Intronic
944783240 2:203041374-203041396 TCTTCTCCCAGGTATCTGAATGG - Intronic
944968236 2:204960947-204960969 TCTTCCACCAGGCACCTGCAAGG - Intronic
945769795 2:214029165-214029187 TCTTCCCCCAGATATTGGGAAGG - Intronic
946340941 2:219068082-219068104 TCTTCCCCTAGGTATCTGCTTGG - Intergenic
948198924 2:236115521-236115543 CTTTCCCCCTGGTATCTGGATGG + Intronic
948961238 2:241339739-241339761 TCTTCCCTCAGATACCTGTGTGG + Intronic
1168914185 20:1472922-1472944 TCTTCCCCTGGGTATCTGCAGGG + Intronic
1169782291 20:9322617-9322639 TCTTCTCCCAAGTACCTGAAAGG + Intronic
1170305782 20:14936237-14936259 TCTTCTCCCAGATCTCTGCAAGG - Intronic
1170607039 20:17882330-17882352 CCTTCCCCCAAGTCTCTGTTGGG + Intergenic
1171445853 20:25204561-25204583 TCTTGCCCCAGGTATGCGTGGGG + Intronic
1172026005 20:31949195-31949217 TCTTTCCCCAGATGTCTGCAGGG - Intronic
1172936563 20:38624679-38624701 TCTTGCCCCAGGCATCTGCATGG + Intronic
1173337367 20:42123727-42123749 TCTGCCCCCAGGTACCTGAGTGG + Intronic
1173502057 20:43561174-43561196 TCTTCCCCCAGGCACCTGCATGG - Intronic
1173512810 20:43643637-43643659 TCCTCCCCCAGATATCTGCATGG - Intronic
1173632362 20:44526267-44526289 TCTTCCTCCAGGTATCTTTATGG - Intergenic
1173970299 20:47147401-47147423 TCTTCACCCAGATATCGGCATGG - Intronic
1174165973 20:48583876-48583898 TCTTCCCCCAGACATCTGCACGG - Intergenic
1174193478 20:48756723-48756745 TCTTTCTCCAGATATCTGCAGGG + Intronic
1174542347 20:51299534-51299556 TCTCCCCCCAGGAAGCTGAAAGG - Intergenic
1174672101 20:52318151-52318173 CCTTTCCCCAGGTATTTGCATGG - Intergenic
1174979565 20:55378291-55378313 TCTGCCCTCTGGTATCTGTGTGG - Intergenic
1175464015 20:59177482-59177504 TCTTACCCCAGGTACCAGCATGG + Intergenic
1175521142 20:59603706-59603728 TCCTCCCCCAGGTGTCTCTGTGG + Intronic
1176347598 21:5764412-5764434 GCTTTCCCCAAGTATCTGTAAGG + Intergenic
1176354412 21:5884996-5885018 GCTTTCCCCAAGTATCTGTAAGG + Intergenic
1176424344 21:6538799-6538821 TCTTGCCCCTGGGATTTGTAGGG + Intergenic
1176497229 21:7560043-7560065 GCTTTCCCCAAGTATCTGTAAGG - Intergenic
1176541919 21:8162482-8162504 GCTTTCCCCAAGTATCTGTAAGG + Intergenic
1176560870 21:8345527-8345549 GCTTTCCCCAAGTATCTGTAAGG + Intergenic
1176884163 21:14234198-14234220 TCTTCCCTCAGCTATCCATATGG - Intergenic
1179699837 21:43147114-43147136 TCTTGCCCCTGGGATTTGTAGGG + Intergenic
1180897927 22:19350843-19350865 ACTTTCTCCAGGTCTCTGTATGG + Intronic
1182754321 22:32666531-32666553 TCTTTCCCCAGGAATCTGGAAGG + Intronic
1182791322 22:32955438-32955460 TCATCCCCCAGGTGTCCGCATGG - Intronic
1183362699 22:37390890-37390912 TCTTCTCCCAGGTCTCTGCCTGG - Intronic
1183669240 22:39262619-39262641 TTTTCCCCCAGGTGTCTGGCTGG + Intergenic
1184581394 22:45420277-45420299 TCTTTCCCCAGATATCTGTAGGG + Intronic
1184608570 22:45588225-45588247 TCTTCCTCCAGATCTCTGTGTGG - Intronic
1203246861 22_KI270733v1_random:78901-78923 GCTTTCCCCAAGTATCTGTAAGG + Intergenic
949709037 3:6853564-6853586 TCTTCCCACAGTCATATGTATGG - Intronic
949815874 3:8057206-8057228 TCTTCCTCCAGTTATCTGCTGGG - Intergenic
950705607 3:14778084-14778106 GCTTCCCCCAGGGATTTTTAAGG + Intergenic
950949737 3:16985910-16985932 TCTTCCTCCTGGTATCTCCAAGG - Intronic
951035165 3:17925076-17925098 TCTTTCTGCAGGTATCTGCATGG - Intronic
952769540 3:36985526-36985548 TTTTCTCCCAGGTATATGCAAGG + Intergenic
952788780 3:37181539-37181561 TCTTCTCCCAGGTATTTACATGG - Intronic
953278857 3:41532268-41532290 TCTTCCCCTGGGTATCTGCATGG + Intronic
953508107 3:43506710-43506732 TCCTCCACTAGGTATCTGCATGG + Intronic
956419614 3:69073388-69073410 TCTTCCTACAGATAACTGTATGG + Intronic
956605524 3:71069611-71069633 TTTTCCCCCCGATATCTGAAGGG - Intronic
959000329 3:100956802-100956824 TCTTCCTCCAAATATCTGAATGG - Intronic
959842254 3:110991101-110991123 TCTTTTCCCAGTTATCTGCATGG - Intergenic
959896861 3:111615951-111615973 TCTTCCCCCAAATATCTACATGG + Intronic
960543237 3:118883628-118883650 TCTTCCCCAAAGTATCTTTTTGG - Intergenic
960970992 3:123140106-123140128 TCTTCCCCCAGGTCTGTATGCGG - Intronic
961627995 3:128276845-128276867 TCTTCTCCCAGGCCTCTGAATGG - Intronic
961698641 3:128724756-128724778 TCTTCCTCCAGGTATCTGCTTGG - Intergenic
963093088 3:141504951-141504973 TCCTTCCCCAGATATCTGTATGG + Intronic
963601865 3:147385512-147385534 CCTTCGCGCAGGTATCTGAATGG + Intergenic
964411965 3:156407273-156407295 TCTTCCCCAAGGTATTTCCAAGG + Intronic
964434777 3:156640091-156640113 TCTTCCCCCAGATATCACCATGG + Intergenic
964911626 3:161789651-161789673 TGTTCCTCCAGGTATGTGCAGGG - Intergenic
965365239 3:167790254-167790276 TTTTCCCCCAGGTGCCTGTTTGG + Intronic
966245602 3:177804626-177804648 TCTTCCCCCAGATATCCATGTGG - Intergenic
966450328 3:180051526-180051548 TCTTCCTTCAGATATCTGCATGG + Intergenic
966939054 3:184733894-184733916 TGTTCACCCTGGTATCTATAGGG + Intergenic
968417726 4:454637-454659 GCCTTCCCCATGTATCTGTAAGG + Intronic
968675692 4:1877775-1877797 GCTGTCCCCAGGTATCTGTGTGG + Intronic
971435653 4:26620183-26620205 TCTTCCCCCAGATCTTTGCATGG + Intronic
971531289 4:27692600-27692622 TCATCCCCAAGATCTCTGTATGG + Intergenic
971705832 4:30041497-30041519 CCTTTCCCCAGGTATCTTCATGG + Intergenic
972547644 4:40095776-40095798 TCTTCCTCAAGATATCTGCACGG - Intronic
972657555 4:41079455-41079477 CCTTCCCCCATGTTTCTCTATGG - Intronic
973787661 4:54348648-54348670 TCTTCCCCCAGATACCTGCTTGG - Intergenic
974384629 4:61189122-61189144 TCTTCACCCAGAGATCTGCATGG - Intergenic
975113366 4:70651456-70651478 TCTTTTCCCATGTATGTGTAGGG + Intronic
975135602 4:70871192-70871214 TCTTCTCCCAGATATCTGCAAGG - Intergenic
975359300 4:73448747-73448769 TCTTCCCCCAGATATTTGCATGG + Intronic
975547154 4:75571443-75571465 TCTTCCCCCAGATATCCACATGG + Intergenic
978875616 4:113637026-113637048 TCCTCCCTCAGGTATCTGCAAGG + Intronic
980851024 4:138381717-138381739 TCTACCCCCAGGTATCTTAGAGG + Intergenic
981301971 4:143197210-143197232 TCTTGTCCCAGGTATTTGCAAGG + Intronic
982135781 4:152272815-152272837 TCTTCCCCAATATTTCTGTAAGG + Intergenic
982821155 4:159941381-159941403 TTTTCTCTCAGGTTTCTGTAGGG + Intergenic
982927695 4:161359941-161359963 CCTTCTCTCAGGTAGCTGTAAGG + Intergenic
983365750 4:166786189-166786211 TCTTCCCCCAGGTATCTGTATGG - Intronic
983525381 4:168755362-168755384 TCTTCCCCCAGATTTCTGCATGG - Intronic
984016064 4:174428473-174428495 TCTTTTCCCAGATATGTGTATGG - Intergenic
984376735 4:178940182-178940204 TCATCCCTCAGGTTTCTGTTTGG - Intergenic
986688407 5:10294026-10294048 TCTTCCTCCAGATATCTGCAGGG - Intronic
987444602 5:18002189-18002211 TCTTCCCCCAAATATCTGTAAGG - Intergenic
988243415 5:28644278-28644300 TCTTTTCCCATGTATCTGTTAGG - Intergenic
988524170 5:31971974-31971996 TCTTCTCCCAGGTAGCTGCACGG + Intronic
988640339 5:33034718-33034740 TCTTCCCCCAAGTATCTGAGTGG + Intergenic
989091239 5:37734731-37734753 TCTTCCCCTAGGTATTTGCATGG - Intronic
989191410 5:38673297-38673319 TCTTCCCCCAAATATCTCCATGG - Intergenic
989702666 5:44289025-44289047 TCTTCCCCAGGATATCTGTATGG - Intergenic
990460757 5:56028927-56028949 TGTTACCACAGGTATGTGTATGG - Intergenic
990519619 5:56566286-56566308 TCTTCTCCCAGGTGTCTACATGG - Intronic
990650509 5:57893468-57893490 TCTTCCTCTAAGTATCTGTGGGG - Intergenic
990793999 5:59519432-59519454 TCTTCCTCTAAGTATCTGGATGG - Intronic
991728309 5:69559226-69559248 TTTTCCCCTAGGTATCAGCAGGG + Intergenic
991804738 5:70414373-70414395 TTTTCCCCTAGGTATCAGTAGGG + Intergenic
991866646 5:71068649-71068671 TTTTCCCCTAGGTATCAGTAGGG - Intergenic
991962794 5:72062576-72062598 TCTTCCCCAAGATACCTGCATGG - Intergenic
993714324 5:91259900-91259922 TGTTCCCCCAGGTATTTTCATGG + Intergenic
994041047 5:95260118-95260140 GCCTTCCCCATGTATCTGTAAGG + Intronic
994070704 5:95598870-95598892 CCTTTCCCCAGATAACTGTAGGG + Intronic
994675629 5:102817927-102817949 TGTTCCTCCAGGTGTCTGCAGGG + Intronic
994694881 5:103061654-103061676 TCTTCCCCCAGGTATACACATGG + Intergenic
995569425 5:113463656-113463678 TCTCCTGCCAGGTATTTGTAAGG - Intronic
995787430 5:115844487-115844509 TCTTCCCCCAGATATCTGCAAGG - Intronic
996541656 5:124636208-124636230 TGTTCCCCCAGATGTCTGCATGG + Intergenic
996689376 5:126321986-126322008 TCTTCCCACAGGAAAATGTATGG - Intergenic
996875826 5:128239364-128239386 TCTTTCCCCAGGTTTTTGCATGG + Intergenic
997281624 5:132651854-132651876 TCTTCCCCCAAATATCTGCATGG + Intergenic
997702964 5:135917780-135917802 TCTTTCCACAGTTATCTGTGAGG - Intergenic
998159843 5:139807182-139807204 TCAGCCCCTAGGTATGTGTAGGG + Intronic
999067910 5:148711310-148711332 TCTTCTCCCAGATATCTATAAGG - Intergenic
999959358 5:156737350-156737372 ACTTCCCCCAACTAACTGTAAGG + Intronic
1000051981 5:157571348-157571370 TCTTCCCCCACGTTTTTGCATGG - Intronic
1000206412 5:159064015-159064037 CCTTCTCCCAGATTTCTGTATGG + Intronic
1000405853 5:160887746-160887768 TCTTCCCCAAGATACCTGTGTGG + Intergenic
1000726670 5:164780175-164780197 CCTTCCTCCAGGTATGTGGAGGG + Intergenic
1001276683 5:170356370-170356392 TTGTCCCCCAGGTATTTGCAAGG - Intronic
1001696175 5:173671673-173671695 TCTTCCCTCAGATTTCTGCATGG - Intergenic
1002073945 5:176697108-176697130 TCTTCCCGCAGCTCTCTGCATGG + Intergenic
1003796240 6:9608410-9608432 TTTTCTTCCAGGTATCTGTCTGG - Intronic
1004155713 6:13166126-13166148 TCTTCCCCCAGATATCCAGATGG + Intronic
1004722387 6:18278320-18278342 CATACCCCCAAGTATCTGTAAGG + Intergenic
1004735912 6:18406340-18406362 TCTTCTCCCAGATATCTGTATGG - Intronic
1004917422 6:20345008-20345030 TCTTCCTCCAGATACCTGCATGG + Intergenic
1004999198 6:21223915-21223937 TCTTCCCCCAGGAAACTTCACGG + Intronic
1005525181 6:26640471-26640493 TCTTCCTCCAGGAATCTTCAAGG + Intronic
1006166004 6:32065344-32065366 TCTTTCCCCAGATATCTTCATGG + Intronic
1007152977 6:39713106-39713128 TCTTCCCTCAGAAATCTGCATGG - Intronic
1007379484 6:41478433-41478455 TCTTCCCCCGGTTATCTGCAGGG + Intergenic
1007440853 6:41858674-41858696 TCTTCCCTCAGATATCTACATGG + Intronic
1007511839 6:42380086-42380108 TCTTCCCCCAGGTATCTGCATGG - Intronic
1009410125 6:63356693-63356715 TCTTCTCCTAGGTATATGCATGG - Intergenic
1009456733 6:63865669-63865691 TTTTTCCCCAGCTATCTGTATGG + Intronic
1009980802 6:70723446-70723468 TCTTTCCCCAGATAGCTGCATGG + Intronic
1010025255 6:71207819-71207841 TGTTCCCCCAGGCATTTGAAGGG - Intergenic
1010862550 6:80931397-80931419 CATTCCCCCAGGTAGTTGTAGGG + Intergenic
1011175858 6:84559660-84559682 TCTTTGCCCATGTATCTGTGGGG - Intergenic
1011710088 6:90044293-90044315 TCTTTTCCCAGATATCTGCATGG - Intronic
1012914740 6:105157273-105157295 TCTTCCCTCAGATATCTGCATGG + Intergenic
1015686886 6:135874146-135874168 TCTTTCCCCAGGTATCTGCATGG - Intronic
1016947418 6:149547400-149547422 TCTTCCTCCAGTTATTTGTATGG + Intergenic
1017170206 6:151449517-151449539 TCTTCTCCCAGGGATCTGAAAGG + Intronic
1017191484 6:151658762-151658784 TCTTCCCTCAGGTGTGTGGAGGG - Intronic
1017289205 6:152715735-152715757 TATTTCCTCAGCTATCTGTATGG - Intronic
1017722764 6:157255511-157255533 TCTTCCCACACCTATCTCTAGGG + Intergenic
1019732537 7:2635852-2635874 TCTTCCCCAAGGTCTCTGTATGG - Intronic
1020436870 7:8174093-8174115 TCTTCCCCCTGAGATCGGTATGG - Intronic
1020784142 7:12553565-12553587 TCTTCCTCCAAGTTTGTGTAGGG - Intergenic
1021067250 7:16191694-16191716 GCTACCCCAAGGTATCTGCATGG + Intronic
1021306051 7:19033989-19034011 TCTTCCCCCAGATGTTTGTTTGG - Intronic
1021576699 7:22111868-22111890 TTTTCCCCCAGGGATTTGCATGG + Intergenic
1021627085 7:22603931-22603953 TCTTCCCCCAAGCATCTGCTGGG + Intronic
1021648395 7:22808692-22808714 TCTCCTCCCAGATATCTATATGG - Intergenic
1021652410 7:22844909-22844931 TCTTCCCCCAGGTTTCATTTTGG - Intergenic
1025104428 7:56159413-56159435 TCTTCCACCAGATGTCTGCATGG - Intergenic
1025250141 7:57346421-57346443 TTTTCAGCCAGGTATCTGTCTGG - Intergenic
1025706183 7:63866457-63866479 TCTCTCCCCAGGTCTCTGAATGG + Intergenic
1025773959 7:64541780-64541802 TCTTCCTCCAGGCCTCTGGAAGG - Intronic
1026166638 7:67915978-67916000 TCTTCACCCAGGTGTCTATATGG + Intergenic
1026997588 7:74628378-74628400 TCATACCCCAGGGATCTGTGAGG - Intergenic
1027488063 7:78786632-78786654 TCTTCTCTTAGGTATCTCTATGG + Intronic
1027776668 7:82473632-82473654 TCTTCCCCCAGATTGCTGTATGG - Intergenic
1028226612 7:88259187-88259209 TCTTCCATCAGGTATCCATATGG + Intergenic
1030185588 7:106758650-106758672 TCTTCCTCCAGATATCTGTGTGG + Intergenic
1030206933 7:106960159-106960181 CCTTTCCCCAGTTACCTGTAAGG + Intergenic
1030318482 7:108140586-108140608 TCTTCCTCCAGGTCTCTGCATGG - Intergenic
1030554668 7:111008397-111008419 TCTTCCCCCAGATATCTTCATGG + Intronic
1030838457 7:114317936-114317958 TCTTCCTCCATTTATCTGCATGG + Intronic
1031091452 7:117360158-117360180 TTTACCCCCAGATATCTGTATGG + Intergenic
1031569645 7:123343055-123343077 TCTTATCCCAGGTGTCTGCATGG - Intergenic
1031575364 7:123409644-123409666 TCCACCCCCAGGTATCTGTCTGG + Intergenic
1032431862 7:131868924-131868946 TCTTCCCCTAGGGAGCTGTGTGG + Intergenic
1033427368 7:141256371-141256393 TCTTCCCCCAAGTATCACTTTGG - Intronic
1033941252 7:146657431-146657453 TCCTCCACCAGGTACCTGAAGGG - Intronic
1034075254 7:148225374-148225396 TCATTCCCCAGGTCTCTGCATGG - Intronic
1034610394 7:152362229-152362251 TTTTCTCCCAGATATCTGTATGG - Intronic
1037130530 8:15403556-15403578 TGTTCCACCAGGAATCTGAAGGG - Intergenic
1037631572 8:20661410-20661432 TCTTCCCCTAGGTAACAGCAAGG + Intergenic
1038536867 8:28359813-28359835 TCTTCCCACAGGTTTATGTGTGG - Exonic
1038712772 8:29963261-29963283 TCATCCCCCTGGTATCTGTAGGG - Intergenic
1039165153 8:34670677-34670699 TCTTCCCTCAGATATCTACATGG + Intergenic
1039261572 8:35777285-35777307 TCTTGCCCCAGCTATTTGGAAGG + Intronic
1039601472 8:38841981-38842003 TATTCTCCCAGGTAGCTGTATGG + Intronic
1039622390 8:39010165-39010187 TCCTCCCCCAAGTATCTGCCTGG - Intronic
1039833561 8:41237087-41237109 CCTCCTCCCAGGAATCTGTAGGG + Intergenic
1042126703 8:65545217-65545239 TCTTCCCACAGCTATCTGCTTGG - Intergenic
1042415100 8:68509737-68509759 ACTTACCCCAGGTATCTGCTAGG - Intronic
1042699625 8:71598127-71598149 TCTTCCCTCAGGTCTTTGCATGG - Intergenic
1043339526 8:79220539-79220561 TCTTCCTCCATGTATATGTTTGG + Intergenic
1043915721 8:85920223-85920245 TCTTCCCCCAGATATCCACAGGG + Intergenic
1044028968 8:87211012-87211034 TCTGCCCCCATGTCTCTGCAGGG - Intronic
1044789224 8:95829640-95829662 TCTTACCCCAGATCTTTGTATGG - Intergenic
1046941143 8:119932841-119932863 TCTTCCACCAGATATCTGCAAGG - Intronic
1047763387 8:127970644-127970666 TCTTCCCCCTGGCACCTGTTAGG - Intergenic
1048000917 8:130379038-130379060 TCTTCCCCCAGACATCTTTTTGG - Intronic
1048084440 8:131161710-131161732 TCTTCTCCCTGGAATCTGCAAGG + Intergenic
1048163253 8:132039779-132039801 TCTTCTCCCATATATCTGCAAGG + Intronic
1048971934 8:139650004-139650026 TCTTTCCCCAGGTAGCTGCCTGG - Intronic
1048982885 8:139712555-139712577 TCTTCCCACTGGTATCTACAAGG + Intergenic
1049592228 8:143467901-143467923 CCTTCCCCTAGGCATGTGTAAGG + Intronic
1050266838 9:3900006-3900028 TCTTCCCCCATAGGTCTGTACGG - Intronic
1051451915 9:17206595-17206617 GCCTTCCCCATGTATCTGTAAGG + Intronic
1052703830 9:31970199-31970221 TCTTCTCCCAAGTCTCTGTGAGG + Intergenic
1053305400 9:36981088-36981110 TCCTCCCCCAGATATCTGCCTGG + Intronic
1054834844 9:69666293-69666315 CCTTCCCCCAAATATCTGCAGGG + Intronic
1055399908 9:75912236-75912258 GCTTCCTCCAGGCATCTTTAAGG - Intronic
1055593565 9:77843241-77843263 TCTTCCCCCAGATATCCGCATGG - Intronic
1056474181 9:86937126-86937148 TTTTCCCACAAATATCTGTAAGG + Intergenic
1056817457 9:89811983-89812005 TCTACCCCCTGTTATCTGAAGGG - Intergenic
1056972197 9:91215267-91215289 TCATCCCTCAGTTATCTGCAGGG + Intronic
1058568762 9:106317159-106317181 TCTTCGCCCTGTAATCTGTATGG + Intergenic
1060313851 9:122489811-122489833 GCCTTCCCCATGTATCTGTAAGG - Intergenic
1061433887 9:130548361-130548383 CCTGCCCCCAGGGCTCTGTATGG + Intergenic
1061782796 9:133005581-133005603 TCTTCGCCCAGCTCTCTGCACGG - Intergenic
1062286502 9:135775299-135775321 TCCTGCCCCAGGTATGTGAAGGG + Exonic
1062594653 9:137293849-137293871 TCTTCCCCTCGGTCTCTTTACGG - Intergenic
1202798547 9_KI270719v1_random:150227-150249 TCCTCCCCCAGATATTTGCATGG + Intergenic
1203696671 Un_GL000214v1:104798-104820 TCTAACCCCAGGTATTTGGAAGG - Intergenic
1203463194 Un_GL000220v1:61963-61985 GCTTTCCCCAAGTATCTGTAAGG + Intergenic
1186088266 X:6014959-6014981 TGTTCCTCCAGGTAACTGTATGG + Intronic
1187302646 X:18065878-18065900 ACTTCCCCTAGGTTTCTGGATGG - Intergenic
1188448929 X:30288473-30288495 TCTTCCCTCAGGAATTTTTAAGG + Intergenic
1189019172 X:37316780-37316802 TCTTCCCACAGATTTCTTTATGG + Intergenic
1189941885 X:46132922-46132944 TCTTCCCCCAGATAACTGAATGG - Intergenic
1190286358 X:48963992-48964014 TCTTCCTCTAGTTATCTGCATGG + Intronic
1190296765 X:49032152-49032174 TGTTCCCTCTGGTATCTTTAGGG + Intronic
1190328603 X:49222059-49222081 TCTTCCCCCAGATATTTGCATGG + Intronic
1190626423 X:52342577-52342599 TCTTCCCTCAGGTAATTGCAAGG - Intergenic
1190701583 X:52993261-52993283 TCTTCCCTCAGGTAATTGCAAGG + Intronic
1191955879 X:66642042-66642064 TCTTCCCCCAGATATCAGCATGG + Intergenic
1196692200 X:118571874-118571896 TCTTCCCTCAGATAGCTGTATGG - Intronic
1198024773 X:132694356-132694378 TCTTCCCCTAGATATCTGCAGGG - Intronic
1198428170 X:136540426-136540448 TCTTTCCCCAGATACCTGCATGG + Intronic
1199174117 X:144764508-144764530 TCTTCCCTCAAGTATCTTCATGG - Intergenic
1199737175 X:150695080-150695102 ATCACCCCCAGGTATCTGTATGG - Intronic
1199905912 X:152229533-152229555 TCTTTCCCCAGGTTTCTACAAGG - Intronic
1200094512 X:153650872-153650894 TCTTCCCCCAGATGTCTTGACGG + Exonic
1200968641 Y:9126059-9126081 TTTTCACCCATGTATCTGGAGGG - Intergenic
1202142184 Y:21736444-21736466 TTTTCACCCATGTATCTGGAGGG + Intergenic
1202144681 Y:21767358-21767380 TTTTCACCCATGTATCTGGAGGG - Intergenic