ID: 983369704

View in Genome Browser
Species Human (GRCh38)
Location 4:166842813-166842835
Sequence GCCGGCAGTGCGGGACTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 286}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983369704_983369710 -2 Left 983369704 4:166842813-166842835 CCTGCCAGTCCCGCACTGCCGGC 0: 1
1: 0
2: 2
3: 42
4: 286
Right 983369710 4:166842834-166842856 GCCTGCACTCCTCAGCCTTTGGG 0: 8
1: 247
2: 637
3: 730
4: 876
983369704_983369713 8 Left 983369704 4:166842813-166842835 CCTGCCAGTCCCGCACTGCCGGC 0: 1
1: 0
2: 2
3: 42
4: 286
Right 983369713 4:166842844-166842866 CTCAGCCTTTGGGCAGTAGATGG No data
983369704_983369715 14 Left 983369704 4:166842813-166842835 CCTGCCAGTCCCGCACTGCCGGC 0: 1
1: 0
2: 2
3: 42
4: 286
Right 983369715 4:166842850-166842872 CTTTGGGCAGTAGATGGAACCGG 0: 1
1: 0
2: 5
3: 110
4: 479
983369704_983369717 29 Left 983369704 4:166842813-166842835 CCTGCCAGTCCCGCACTGCCGGC 0: 1
1: 0
2: 2
3: 42
4: 286
Right 983369717 4:166842865-166842887 GGAACCGGGTGCTGTGTAGCAGG 0: 1
1: 0
2: 6
3: 83
4: 414
983369704_983369716 15 Left 983369704 4:166842813-166842835 CCTGCCAGTCCCGCACTGCCGGC 0: 1
1: 0
2: 2
3: 42
4: 286
Right 983369716 4:166842851-166842873 TTTGGGCAGTAGATGGAACCGGG 0: 1
1: 0
2: 6
3: 82
4: 369
983369704_983369709 -3 Left 983369704 4:166842813-166842835 CCTGCCAGTCCCGCACTGCCGGC 0: 1
1: 0
2: 2
3: 42
4: 286
Right 983369709 4:166842833-166842855 GGCCTGCACTCCTCAGCCTTTGG No data
983369704_983369718 30 Left 983369704 4:166842813-166842835 CCTGCCAGTCCCGCACTGCCGGC 0: 1
1: 0
2: 2
3: 42
4: 286
Right 983369718 4:166842866-166842888 GAACCGGGTGCTGTGTAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983369704 Original CRISPR GCCGGCAGTGCGGGACTGGC AGG (reversed) Intronic
900203142 1:1420188-1420210 GCCGGCGGCGCGGGCCTGGACGG - Exonic
900312971 1:2043363-2043385 GTCTGCAGTGCAGGAGTGGCAGG + Intergenic
900411456 1:2514559-2514581 GTCGGCCGTGGGGGACTGTCTGG + Intronic
901045914 1:6395749-6395771 GCACACAGTGCGGGACTAGCAGG - Intergenic
901061588 1:6474271-6474293 GCTGGCAGGGCGGGGCTGTCGGG - Intronic
901591926 1:10351563-10351585 GCCTCCAGTGCTGGACTGCCTGG - Intronic
902467239 1:16625918-16625940 GCCGGCAGAGCAGGAGTGGCTGG - Intergenic
902798650 1:18815869-18815891 GCTGGGGGTGGGGGACTGGCGGG - Intergenic
902819649 1:18936198-18936220 GCTGGCAGGGAGGGGCTGGCAGG - Intronic
903138440 1:21324371-21324393 TCCATCAGTGCGGGACTGACAGG + Intronic
903361691 1:22781022-22781044 CCCGGCCGTGAGGGTCTGGCCGG + Intronic
905643991 1:39611813-39611835 GCACGCAGTGCGGGACTGGTGGG - Intergenic
905742968 1:40388237-40388259 GCGCACAGCGCGGGACTGGCGGG + Intronic
906109282 1:43312470-43312492 GAGGGCAGTGCGGGCCTGGGGGG - Exonic
906318515 1:44803043-44803065 GCAGGCAGTGAGAGGCTGGCAGG - Exonic
907759439 1:57343425-57343447 GCGCACGGTGCGGGACTGGCAGG - Intronic
909317958 1:74247875-74247897 GCACGCAGCGTGGGACTGGCAGG - Intronic
909782212 1:79561503-79561525 GTGTGCAGAGCGGGACTGGCGGG - Intergenic
910139585 1:84012422-84012444 GCTGGCAGTGGGGGAGAGGCAGG + Intergenic
911854026 1:102854177-102854199 ACGCGCGGTGCGGGACTGGCGGG + Intergenic
912166143 1:107044862-107044884 GCCGGCAGGGCGGGGCCGGCAGG - Intergenic
918790040 1:188813404-188813426 GCGGGCGCTGTGGGACTGGCAGG + Intergenic
920037275 1:203074655-203074677 GCAGGCAGAGTGGGACTAGCAGG - Intronic
921396309 1:214673122-214673144 GCGCACAGCGCGGGACTGGCAGG - Intergenic
923353254 1:233129505-233129527 GTTCACAGTGCGGGACTGGCAGG + Intronic
924313704 1:242774344-242774366 GCAAGCCGTGTGGGACTGGCGGG - Intergenic
1063965158 10:11340738-11340760 GCGGGCAGAGCTGGGCTGGCGGG - Intergenic
1064328949 10:14376062-14376084 GCCGGCTGTGAAGGACTGACTGG - Intronic
1064418282 10:15168826-15168848 GCGGGCAGGGCGGGGCCGGCGGG - Intergenic
1066064182 10:31750411-31750433 GGCGGCAGTGCAAGCCTGGCTGG - Intergenic
1067116169 10:43437045-43437067 GCAGGGAGCGCTGGACTGGCGGG + Intronic
1067560371 10:47300763-47300785 GCGGGCAGTGCGGACCAGGCGGG - Exonic
1067800283 10:49353829-49353851 ACAGGCAGTGCAGGATTGGCTGG + Intergenic
1067893167 10:50153102-50153124 GCCGGCATTTCCGGCCTGGCAGG - Intergenic
1068216752 10:53991197-53991219 GCGCGCGGTGCGGGACTGGCAGG + Intronic
1068554889 10:58448240-58448262 GCGCACAGCGCGGGACTGGCGGG - Intergenic
1069587933 10:69620963-69620985 GCAGGCAGTGAGAGACTGCCTGG + Intergenic
1069633287 10:69910536-69910558 GCCTGCCTTGCGGGTCTGGCTGG - Intronic
1069712566 10:70499454-70499476 GCCCGCAGTGTGAGGCTGGCAGG + Intronic
1069806996 10:71132359-71132381 GCAGGCCTTGTGGGACTGGCTGG + Intergenic
1069993046 10:72326339-72326361 GCCCACAGCGCGGGACTGGCAGG + Intergenic
1070817612 10:79335303-79335325 GCTGGCTCTGTGGGACTGGCAGG + Intergenic
1073532587 10:104245558-104245580 GCGCACAGTGCAGGACTGGCAGG + Intronic
1075185401 10:120251942-120251964 GCAGGTGCTGCGGGACTGGCAGG - Intergenic
1076773685 10:132681039-132681061 GCGCACAGCGCGGGACTGGCAGG + Intronic
1076796463 10:132800920-132800942 GCGCACAGCGCGGGACTGGCAGG - Intergenic
1076891077 10:133283712-133283734 GCAGGGAGTGCGGGAGAGGCAGG - Intronic
1077008065 11:368554-368576 GCCGGCTCCGCGGGACAGGCTGG - Intergenic
1077063736 11:628849-628871 GCCAGCAATGTGGGGCTGGCTGG + Intergenic
1077505433 11:2927984-2928006 GCCCGCAGTGTGGGGCGGGCAGG - Intergenic
1081428457 11:42950271-42950293 GCGCACAGTGCGGGACTGGCAGG + Intergenic
1083746023 11:64736881-64736903 GCTGGCACTGCCTGACTGGCTGG - Exonic
1084005785 11:66322861-66322883 GGCGGCAGGGCGGGCCGGGCTGG + Intergenic
1084186714 11:67476438-67476460 GCGCACGGTGCGGGACTGGCAGG + Intergenic
1084265715 11:68004135-68004157 GCCCGCAGGGCGGGACAGGGCGG - Intronic
1084267149 11:68010902-68010924 GCAGGCGGGGCGGGGCTGGCTGG - Intronic
1086484719 11:87286495-87286517 GCGCGCAGCACGGGACTGGCAGG - Intronic
1087977190 11:104564927-104564949 GCGCGCAGCACGGGACTGGCGGG - Intergenic
1088481644 11:110300911-110300933 GCGCACGGTGCGGGACTGGCAGG - Intergenic
1091005134 11:131946170-131946192 GCAGGCAGTGGGAGACTCGCGGG + Intronic
1091240117 11:134046475-134046497 GCTGGCAGGGCAGGACTAGCTGG - Intergenic
1092135271 12:6142582-6142604 GCGCACAGCGCGGGACTGGCAGG + Intergenic
1092137499 12:6159860-6159882 GCACACAGCGCGGGACTGGCAGG + Intergenic
1092221471 12:6716421-6716443 GCGCACAGCGCGGGACTGGCAGG + Intergenic
1092422256 12:8341586-8341608 CCAGGCAGTGCGGGCCTGACTGG - Intergenic
1093583179 12:20807365-20807387 GCAGGGCATGCGGGACTGGCGGG - Intergenic
1095123161 12:38442334-38442356 GCGCACAGTGCAGGACTGGCAGG + Intergenic
1096191589 12:49623495-49623517 GCCGGGAGGGCGGGGCCGGCGGG - Exonic
1096216341 12:49799700-49799722 GCAGGCATTCCGGGCCTGGCTGG + Intronic
1096866792 12:54569238-54569260 TTCGGAGGTGCGGGACTGGCTGG + Exonic
1099523872 12:83696270-83696292 GCGCACAGCGCGGGACTGGCAGG - Intergenic
1103410924 12:120710811-120710833 GCCGGCCGAGGGGGTCTGGCGGG - Intronic
1104769145 12:131349869-131349891 GCCGGCCGTGCTGGGCTGGTGGG + Intergenic
1105605097 13:21920677-21920699 GCGCACAGTGCGGGACTGGCAGG - Intergenic
1105723978 13:23142530-23142552 GCATGCAGGGCGGGACTGGTGGG + Intergenic
1106517102 13:30465224-30465246 GGCGGCAGTGCGGGCCCGGCCGG - Intronic
1107259313 13:38472405-38472427 GCCGACGGCGCAGGACTGGCAGG - Intergenic
1108686803 13:52826641-52826663 GCGGGAGGTGCGGGAGTGGCAGG + Intergenic
1108750186 13:53440033-53440055 GCCTGCAGTGTGGGACTGGTAGG + Intergenic
1108751468 13:53452369-53452391 GCGCGCAGCGCGGGACTGGCAGG - Intergenic
1109007831 13:56901115-56901137 GCACACAGTGCAGGACTGGCAGG + Intergenic
1109037664 13:57286588-57286610 GCTCGCGGCGCGGGACTGGCGGG - Intergenic
1109145461 13:58773657-58773679 GCGCACAGTGCGGGACTGGCAGG + Intergenic
1109446538 13:62447874-62447896 GCGCACAGCGCGGGACTGGCAGG - Intergenic
1109745885 13:66622334-66622356 GCCCACAGCGTGGGACTGGCAGG + Intronic
1110170956 13:72499437-72499459 GCAGGGAGTGAGGGACTAGCTGG - Intergenic
1111556107 13:89883841-89883863 GCGCACGGTGCGGGACTGGCAGG - Intergenic
1113567255 13:111326472-111326494 GCGGGCAGTGCGAGCCTGTCTGG + Intronic
1113567284 13:111326599-111326621 GCGGGCAGTGCGAGCCTGTCTGG + Intronic
1114031528 14:18584236-18584258 GCCGCCAGGGAGGGACTGGAGGG - Intergenic
1115174520 14:30547483-30547505 GCGTGCAGTGCGGGACTGGTAGG - Intergenic
1115850079 14:37584044-37584066 CCCGGCCGGGCGGGGCTGGCAGG - Intergenic
1117546717 14:56798832-56798854 GGCGGCAGTACGGGCCTGGGGGG + Intergenic
1119300250 14:73566308-73566330 GCTCACGGTGCGGGACTGGCAGG - Intergenic
1121145466 14:91578359-91578381 GCCAGCGGTGCGGGACTGGCGGG + Intergenic
1121350590 14:93170089-93170111 CACGGCAGCGAGGGACTGGCAGG - Intergenic
1121667869 14:95686345-95686367 GCCGGCAGTGGGGGCGGGGCCGG - Intergenic
1122435060 14:101689469-101689491 GGCCACAGTGCGGGACTGGCGGG + Intergenic
1122707284 14:103629235-103629257 GGCGGCCGAGCGGGACTGGCTGG + Intronic
1123825513 15:24078411-24078433 GCGTGCAGTGCAGGACTGGCGGG - Intergenic
1126320073 15:47412311-47412333 GCCGGCAGTGCTGGGCAGACAGG + Intronic
1129777434 15:78246112-78246134 GCGCACAGCGCGGGACTGGCAGG - Intergenic
1131144327 15:90001657-90001679 GCCGGCAGCGCGGGGCTGCGGGG - Intronic
1131992320 15:98104240-98104262 GCCCACGGCGCGGGACTGGCAGG - Intergenic
1132292473 15:100713236-100713258 GCCAGCCGTGGGGGACAGGCAGG - Intergenic
1132496651 16:266530-266552 GGCGGCAGTGAGGGGCAGGCAGG + Intronic
1132759125 16:1500463-1500485 GCCGGAACTGCGGGACAGCCGGG + Exonic
1132942338 16:2514372-2514394 GCAGGGCGTGCGGGCCTGGCCGG + Intronic
1132954945 16:2586593-2586615 AGCGGCAGTGCGGGAGGGGCTGG + Intronic
1133119248 16:3596170-3596192 CCCGGCAGTGGGGGCCTGGCTGG - Exonic
1133246901 16:4455116-4455138 GCCTGTAGTGCAGGACTGGCTGG + Intronic
1133814213 16:9184175-9184197 GCGCGCTGTGCGGGACTGGTAGG - Intergenic
1133950308 16:10385946-10385968 GCTGGCTGTGCCTGACTGGCTGG + Intronic
1135280927 16:21152983-21153005 GCCCACGGCGCGGGACTGGCAGG + Intronic
1135942631 16:26836074-26836096 GCACACGGTGCGGGACTGGCAGG - Intergenic
1136163366 16:28435754-28435776 GTAGACAGCGCGGGACTGGCAGG + Intergenic
1136199597 16:28679233-28679255 GTAGACAGCGCGGGACTGGCAGG - Intergenic
1136215943 16:28793406-28793428 GTAGACAGCGCGGGACTGGCAGG - Intergenic
1136536858 16:30904583-30904605 GCCGGCAGGATGGGACTGCCAGG + Intergenic
1136822898 16:33336719-33336741 GCCGGCTGTGCTGGCTTGGCTGG + Intergenic
1136823186 16:33337973-33337995 GCCGGCTGTGCTGGCTTGGCTGG + Intergenic
1136823582 16:33339672-33339694 GCCGGCTGTGCTGGCTTGGCTGG + Intergenic
1136834507 16:33491941-33491963 GCCGGCTGTGCTGGCTTGGCTGG + Intergenic
1141456379 16:84145110-84145132 GGCGGCCGCGCGGGTCTGGCGGG - Exonic
1142209871 16:88803925-88803947 GCGCGGAGTGCGGGCCTGGCGGG - Exonic
1203010294 16_KI270728v1_random:232091-232113 GCCGGCTGTGCTGGCTTGGCTGG - Intergenic
1203144822 16_KI270728v1_random:1792872-1792894 GCCGGCTGGGCCGGCCTGGCTGG + Intergenic
1142747183 17:1965731-1965753 GAGGGCAGTGGGGGCCTGGCGGG - Intronic
1145989548 17:29070704-29070726 GCTGGCCGTGTGGGACTGGAGGG - Intergenic
1147587834 17:41662825-41662847 GCCGGTGGTCCGGGGCTGGCCGG + Intergenic
1149626336 17:58083303-58083325 GCCCGCAGTGCGGGGCCGGGCGG + Intergenic
1149863999 17:60140200-60140222 CCAGGCAGTGCGGGACAGGTGGG + Intergenic
1150574312 17:66416452-66416474 GCCGGCAGCTGGGGACTGACAGG + Intronic
1150775883 17:68081000-68081022 GCGCACAGCGCGGGACTGGCAGG + Intergenic
1151840573 17:76614892-76614914 GCACGCAGCGTGGGACTGGCGGG - Intergenic
1152356189 17:79808784-79808806 GCCAGCAGTGTGGGGCTGGAGGG - Intergenic
1152415652 17:80160018-80160040 GAGAGCAGTGTGGGACTGGCCGG + Intergenic
1152475743 17:80516890-80516912 ACCGGCAGTTGTGGACTGGCTGG + Intergenic
1152535907 17:80950257-80950279 GCCGGCAGAGGGGGGCTGGCGGG - Intronic
1153094344 18:1383589-1383611 TCCAGCAGTGGGGCACTGGCAGG - Intergenic
1153893172 18:9536636-9536658 CCCCGCAGTGAGGAACTGGCAGG - Exonic
1154945314 18:21157052-21157074 GGTGGCAGTGCTGGACTGGGTGG + Intergenic
1156040386 18:32814194-32814216 GCAGGCAGTGGGGGACAGGGTGG - Intergenic
1156150381 18:34234229-34234251 GCCCACGGCGCGGGACTGGCAGG + Intergenic
1156242968 18:35271627-35271649 GCACGCGGTGCAGGACTGGCAGG - Intronic
1156683640 18:39618850-39618872 GCATGCAGCGCGGTACTGGCAGG + Intergenic
1157661892 18:49452743-49452765 GCGCACAGCGCGGGACTGGCAGG + Intronic
1160503016 18:79411506-79411528 GCCGGCAGCGCGGGGCGGGACGG + Intronic
1160566260 18:79788328-79788350 GGCGGGAGCGCGGGACAGGCGGG - Intergenic
1160899173 19:1418551-1418573 GCCGGCGGGGCGGGGCGGGCCGG + Intronic
1162356167 19:10186320-10186342 GCAGGCAGTGAGGAGCTGGCGGG + Intronic
1162469348 19:10863089-10863111 GGGGGCAGTGCGGGGATGGCAGG + Intronic
1162987166 19:14277992-14278014 GCGCACAGCGCGGGACTGGCAGG + Intergenic
1163103022 19:15109007-15109029 GCAGGCAGTGAGGGGCTGGGTGG + Intronic
1163501641 19:17679906-17679928 TCAGGCAGTGGGGGACCGGCTGG + Intronic
1163835344 19:19570054-19570076 GCCGGCTCTGAGGGACTGGAGGG - Intronic
1164143964 19:22498963-22498985 GCGCACAGCGCGGGACTGGCAGG - Intronic
1164644009 19:29844932-29844954 GCCCGCACTGCGGGAGGGGCAGG + Intergenic
1165081567 19:33310007-33310029 GCAGCCAGAGCGGGACTAGCGGG + Intergenic
1166107028 19:40602502-40602524 GCCGGCCGGGCTGGGCTGGCTGG - Intronic
1166329955 19:42072069-42072091 GGTGGTAGTGCAGGACTGGCTGG - Intronic
1166858010 19:45792775-45792797 GGCGGCAGTCCGGCAGTGGCGGG - Exonic
1168257600 19:55175198-55175220 GCGGCCAGTGCAGGCCTGGCGGG - Exonic
1168337663 19:55605606-55605628 GCGGGCGGTGCGGGGCTGCCGGG + Intronic
926035191 2:9630760-9630782 GCCGGCCGGGCGGGGGTGGCGGG - Intronic
927357141 2:22186684-22186706 GCCCACCGCGCGGGACTGGCAGG + Intergenic
928511723 2:32009963-32009985 GCCGGCAGCCCGGGGCCGGCCGG - Intronic
931775076 2:65533262-65533284 CCCTGCAGGGTGGGACTGGCTGG + Intergenic
933139883 2:78779382-78779404 GCCCGCGGGGCGGGACTGGTGGG + Intergenic
933689307 2:85167225-85167247 TCCAGCAATGTGGGACTGGCTGG + Intronic
935685663 2:105680486-105680508 GCAGGCAGTGAGGGACTTGCAGG + Intergenic
936554199 2:113478844-113478866 GCCAGAAGTGTGGGACAGGCAGG + Intronic
936865337 2:117071566-117071588 GCCCGTGGTGTGGGACTGGCAGG - Intergenic
938496668 2:131801557-131801579 GCCGCCAGGGAGGGACTGGAGGG + Exonic
939003195 2:136758806-136758828 GCGGACAGTGCAGGACTGGCAGG + Intergenic
939281822 2:140074165-140074187 GCGCACGGTGCGGGACTGGCAGG + Intergenic
939869122 2:147507303-147507325 GCACACAGTGCGGGACTGGCAGG + Intergenic
941397862 2:164994729-164994751 GCCCATGGTGCGGGACTGGCAGG - Intergenic
941927996 2:170915327-170915349 GCTCCCAGTGCAGGACTGGCAGG - Intergenic
943680362 2:190761222-190761244 GCCGGCAGGGCCGGCCGGGCCGG + Intergenic
944058422 2:195547326-195547348 CATGGCAGCGCGGGACTGGCAGG - Intergenic
944811065 2:203328200-203328222 GCCGGAAGTGGGGGAGGGGCCGG + Exonic
945993966 2:216420376-216420398 ACCAGCAGTGAGGGACAGGCCGG + Exonic
946702116 2:222424500-222424522 GCCCGGAGTGCGGGATCGGCGGG + Exonic
946923494 2:224603676-224603698 GCGCACAGCGCGGGACTGGCAGG - Intergenic
1170246539 20:14226892-14226914 GCGCACAGCGCGGGACTGGCAGG + Intronic
1171492014 20:25526649-25526671 ACCGGCAGTGTGGGAATGGGAGG - Intronic
1175698960 20:61123629-61123651 GCAGCCTCTGCGGGACTGGCTGG - Intergenic
1175877648 20:62238126-62238148 GGCGGCAGTGCGGGCCTGCGAGG - Intronic
1177219682 21:18175569-18175591 GGCGACAGTGCGAGACTGTCTGG + Intronic
1177318784 21:19493928-19493950 GCGGACCGGGCGGGACTGGCAGG + Intergenic
1177669579 21:24208656-24208678 CGCTGCAGTGCAGGACTGGCGGG - Intergenic
1178054598 21:28784143-28784165 GCACACAGCGCGGGACTGGCAGG + Intergenic
1179833351 21:44012204-44012226 GCCGGCCGCGCGGGACCGGGAGG - Intergenic
1180455640 22:15511293-15511315 GCCGCCAGGGAGGGACTGGAGGG - Intergenic
1181036880 22:20174034-20174056 GACGGCACTGCGGGCCTGGAGGG + Intergenic
1181270830 22:21657657-21657679 GCCCGTCGTGCGGGACTGCCGGG - Intronic
1183983744 22:41557889-41557911 GCCAGCAGAGGGGGAGTGGCTGG - Intergenic
1184060749 22:42079626-42079648 GCCGGCACTGCGCGAGTGGGAGG + Intergenic
1184402236 22:44280835-44280857 GCAGGTTGTGCGGCACTGGCGGG + Intronic
1185372191 22:50466090-50466112 GCCGGCAGTCAGGGACCTGCAGG + Intronic
950256588 3:11511571-11511593 GCGCACAGTACGGGACTGGCAGG - Intronic
951146526 3:19234259-19234281 GCCCACAGCGCGGGACTGGCAGG - Intronic
951551806 3:23882506-23882528 GCGCACAGTGCGGGACTGGCGGG - Intronic
951881487 3:27484525-27484547 GCTGGCGGTGCCAGACTGGCAGG - Intergenic
952883436 3:37999075-37999097 GGGGGCGGGGCGGGACTGGCGGG + Intronic
954409705 3:50365097-50365119 GCAGCCAGTGCGAGGCTGGCCGG - Exonic
955449547 3:59051243-59051265 GCGCACGGTGCGGGACTGGCAGG + Intergenic
955818806 3:62874881-62874903 GCCGGCAGCGCCGGGCTGGGGGG - Exonic
956438890 3:69260638-69260660 GCGCGTGGTGCGGGACTGGCGGG + Intronic
957386511 3:79502607-79502629 GCGCACAGCGCGGGACTGGCGGG + Intronic
957446187 3:80314834-80314856 GCGCACAGCGCGGGACTGGCAGG + Intergenic
961932253 3:130547039-130547061 GCAGGCCGCGCAGGACTGGCGGG - Intergenic
962177172 3:133167374-133167396 GCGCACAGCGCGGGACTGGCAGG - Intronic
962383696 3:134916330-134916352 GCACACAGCGCGGGACTGGCAGG - Intronic
964974246 3:162600089-162600111 CACGGCGGCGCGGGACTGGCAGG + Intergenic
964977825 3:162640457-162640479 GCGCACAGCGCGGGACTGGCAGG + Intergenic
965288113 3:166843197-166843219 GCGCACAGCGCGGGACTGGCAGG + Intergenic
965298196 3:166976219-166976241 GTGCACAGTGCGGGACTGGCAGG + Intergenic
965446534 3:168780494-168780516 GCGCACAGTGCGGGACTGGCAGG + Intergenic
965728645 3:171746263-171746285 GCTCGCAGCGCGGGACTGGCGGG + Intronic
966182966 3:177203849-177203871 GCACGCAGCGTGGGACTGGCAGG - Intergenic
967594849 3:191316987-191317009 GCACGCAGTGCGGGACTAACGGG - Intronic
968662391 4:1804104-1804126 GGTGGCGGTGTGGGACTGGCTGG + Intronic
968904549 4:3445344-3445366 GCCTGCGGTGCGCGGCTGGCGGG + Exonic
969365873 4:6694080-6694102 GCCGGCAGTGCTGGACTCAGCGG + Intronic
970574510 4:17414279-17414301 GCGCGCGGTGCCGGACTGGCGGG - Intergenic
972344712 4:38182956-38182978 GCTGGCGCTGCGGGACTGGCGGG + Intergenic
973684379 4:53354413-53354435 GCCTGCACTGCGGCGCTGGCAGG - Intronic
973758387 4:54096578-54096600 GCAGGCAGGGCGGGACAGCCGGG - Intronic
974069445 4:57110478-57110500 GCCGGGAGGGCGGCACGGGCGGG - Intergenic
977641241 4:99360062-99360084 GCGCACAGCGCGGGACTGGCTGG + Intergenic
977717280 4:100196494-100196516 GCGCACGGTGCGGGACTGGCAGG - Intergenic
978886626 4:113772725-113772747 GTGTGCAGTGGGGGACTGGCTGG + Intergenic
978929743 4:114296152-114296174 GCACGCAGCGTGGGACTGGCAGG - Intergenic
979445615 4:120808585-120808607 GCACACAGCGCGGGACTGGCAGG - Intronic
979609087 4:122670601-122670623 CCCTGCGGTGAGGGACTGGCAGG + Intergenic
979865284 4:125745374-125745396 GCACGCGGTGAGGGACTGGCAGG + Intergenic
980148164 4:129015082-129015104 GCTGGCAGGGTGGGACTGGCTGG + Intronic
980943403 4:139295856-139295878 GCCGGAAGTGCGGGACTCGAGGG + Exonic
981964042 4:150579975-150579997 GCCGGGAGAGCGCGACTGGCCGG - Intronic
983369704 4:166842813-166842835 GCCGGCAGTGCGGGACTGGCAGG - Intronic
985767411 5:1787289-1787311 GCAGGCAGAGCAGGCCTGGCCGG - Intergenic
985805258 5:2038842-2038864 GCCAGGAGTGCAGCACTGGCTGG - Intergenic
987084410 5:14455868-14455890 GTGTGCAGTGCGGGACTGGCGGG - Intronic
987146181 5:14993778-14993800 GCGCACAGCGCGGGACTGGCAGG - Intergenic
987896362 5:23951683-23951705 GCGCGCGGCGCGGGACTGGCAGG + Exonic
989957997 5:50377217-50377239 GTGCACAGTGCGGGACTGGCAGG + Intergenic
991427152 5:66503628-66503650 CACGGCGGCGCGGGACTGGCAGG + Intergenic
993031854 5:82714783-82714805 GCCGGCAGGGCTGGCCAGGCCGG - Intergenic
994570369 5:101506415-101506437 GCATGCAGTGCGGGGCTGGTGGG + Intergenic
994769717 5:103966300-103966322 GCGCACAGCGCGGGACTGGCAGG - Intergenic
995112315 5:108442055-108442077 GTGCACAGTGCGGGACTGGCAGG - Intergenic
997582799 5:135028050-135028072 GCGGGCAGTGCGGGCCTGGCGGG - Exonic
1002616522 5:180459561-180459583 GCACACAGCGCGGGACTGGCCGG + Intergenic
1002670406 5:180861589-180861611 CCCGGAAGTGGGGGCCTGGCGGG + Intergenic
1002758090 6:179993-180015 GTGTGCAGTGTGGGACTGGCGGG + Intergenic
1003060794 6:2860527-2860549 GCGCACGGTGCGGGACTGGCAGG + Intergenic
1003174916 6:3747186-3747208 GCCTGAGGTGCAGGACTGGCAGG - Intronic
1004502086 6:16218194-16218216 GCACACGGTGCGGGACTGGCAGG - Intergenic
1004720457 6:18264253-18264275 GCCGGCAGCTCGGGCCGGGCCGG - Intronic
1004906869 6:20244744-20244766 GCGCACAGTGCGGGACTGGCAGG - Intergenic
1006297437 6:33176169-33176191 GACGGCAGTGCGGGGCAGGCTGG + Intronic
1008005520 6:46405740-46405762 GCGCACGGTGCGGGACTGGCAGG - Intronic
1008230960 6:48984291-48984313 GCACACAGTGTGGGACTGGCAGG + Intergenic
1009936673 6:70242296-70242318 GCAGGCAGTGCGGGGGTGGCGGG - Intronic
1012851054 6:104446673-104446695 GCCCACAGCGCAGGACTGGCAGG + Intergenic
1015905016 6:138107644-138107666 GCCAGGAGAGCGGGACTGGAGGG - Intergenic
1016203714 6:141446410-141446432 GCCGACAGTGTGGGACTGCAAGG - Intergenic
1016482247 6:144495123-144495145 GCCCACGGTGCGGGACTGGAAGG - Intronic
1017581827 6:155873223-155873245 GTCAGCAGTGAGGGCCTGGCCGG - Intergenic
1017882817 6:158573385-158573407 GCCAGCAGTGAGGGACGGTCAGG - Intronic
1019288645 7:236326-236348 GCCAGCAGTGCTGGACAGCCTGG - Intronic
1019562612 7:1665996-1666018 GCCGGCAGGGCGGGAGGGGGAGG + Intergenic
1021359337 7:19692224-19692246 GTGTGCGGTGCGGGACTGGCAGG - Intergenic
1026858466 7:73769995-73770017 GCTGGCCGTGCTGGGCTGGCTGG - Exonic
1027665963 7:81043095-81043117 GCACACGGTGCGGGACTGGCAGG + Intergenic
1027668817 7:81071493-81071515 GAACGCAGTGCGGGACTGGCGGG + Intergenic
1030102068 7:105955783-105955805 GCGCACAGCGCGGGACTGGCAGG - Intronic
1030215661 7:107042335-107042357 GCGCACAGCGCGGGACTGGCAGG - Intergenic
1031292192 7:119951484-119951506 GCGCACAGCGCGGGACTGGCAGG - Intergenic
1031483507 7:122304281-122304303 GCAGGAAGTGGGGGACTGGCAGG + Exonic
1033758548 7:144417943-144417965 GCACACAGCGCGGGACTGGCAGG - Intergenic
1034618079 7:152436041-152436063 GCGGGCGGTGCGGGGCGGGCGGG + Intergenic
1035227234 7:157440452-157440474 GCCCGCAGTGGAGGACAGGCGGG - Intergenic
1035826816 8:2653843-2653865 GCCGGCAGTGCTGGGCTCTCAGG + Intergenic
1036751978 8:11449344-11449366 GCCGGCAGAGAGGTGCTGGCCGG + Intronic
1037692164 8:21190905-21190927 GCAGGCAGTGGCAGACTGGCCGG - Intergenic
1040014544 8:42689899-42689921 GCGCCCGGTGCGGGACTGGCAGG + Intergenic
1040952642 8:52952830-52952852 GTGCACAGTGCGGGACTGGCAGG - Intergenic
1044633406 8:94300307-94300329 GCACACAGTGCGGGACTGGCAGG - Intergenic
1045063301 8:98426398-98426420 GCTGGCTGTGCGGGACTGCAGGG - Intronic
1045096292 8:98800973-98800995 GCGCACAGTGCGGGACTGGCAGG + Intronic
1045232261 8:100316746-100316768 GCGCACGGTGCGGGACTGGCAGG - Intronic
1045933802 8:107655985-107656007 GCACGCGGTGCGGGACTGGCAGG + Intergenic
1048112920 8:131487415-131487437 GCGCGCGGTGCAGGACTGGCAGG + Intergenic
1049500381 8:142959863-142959885 GCGCACAGTGCGGGACTGGCAGG + Intergenic
1049719154 8:144107641-144107663 GCCTGCGGTGTGGGAGTGGCCGG + Intronic
1049778388 8:144416534-144416556 GCTGGCAGGGCGGAGCTGGCGGG + Intronic
1049898804 9:138334-138356 GCCAGAAGTGTGGGACAGGCAGG - Intronic
1049944444 9:580745-580767 GCGCACAGCGCGGGACTGGCAGG - Intronic
1050173194 9:2843872-2843894 GCAAGAAGGGCGGGACTGGCCGG - Intronic
1051314111 9:15810372-15810394 GCACACAGTGTGGGACTGGCAGG - Intronic
1052991496 9:34521576-34521598 GTCGGCAGAGCGAGAATGGCAGG + Exonic
1053430794 9:38040583-38040605 GCAGGTAGTGCTGGAGTGGCTGG + Intronic
1053741857 9:41148646-41148668 GCCAGAAGTGTGGGACAGGCAGG - Intronic
1053870931 9:42491103-42491125 GCAGACAGTGCTGGACTCGCTGG + Intergenic
1054347119 9:63978454-63978476 GCCAGAAGTGTGGGACAGGCAGG - Intergenic
1054444851 9:65304794-65304816 GCCAGAAGTGTGGGACAGGCAGG - Intergenic
1054485420 9:65716712-65716734 GCCAGAAGTGTGGGACAGGCAGG + Intronic
1054686486 9:68282654-68282676 GCCAGAAGTGTGGGACAGGCAGG + Intronic
1056735999 9:89209745-89209767 GCGAACAGCGCGGGACTGGCAGG + Intergenic
1057907124 9:98992093-98992115 GGAGGCAGCGTGGGACTGGCAGG - Intronic
1058309560 9:103484062-103484084 GCATGCAGTGTGGGACTGGCAGG + Intergenic
1061415484 9:130444952-130444974 GGCGGCAGAGCAGGACTGGCAGG - Exonic
1062338414 9:136082630-136082652 GGAGGCAGCGCGGGCCTGGCGGG - Intronic
1062646743 9:137551728-137551750 GCCGGCGGTGCGGGGCTCGCGGG - Exonic
1187139120 X:16575838-16575860 GCACACGGTGCGGGACTGGCAGG + Intergenic
1188166897 X:26873675-26873697 GCGCACGGTGCGGGACTGGCAGG - Intergenic
1190879672 X:54483470-54483492 GCGGGAAAGGCGGGACTGGCAGG - Intronic
1194204539 X:90995788-90995810 GCGCACGGTGCGGGACTGGCCGG + Intergenic
1194890422 X:99372046-99372068 GGCCGCGGCGCGGGACTGGCAGG - Intergenic
1195702569 X:107716268-107716290 GCCGGCTGTGGGGGACTCCCCGG - Intronic
1195896303 X:109749309-109749331 GCCCACAGCACGGGACTGGCAGG - Intergenic
1196197861 X:112854874-112854896 GGTGGAGGTGCGGGACTGGCAGG - Intergenic
1196319468 X:114270535-114270557 GCGCACGGTGCGGGACTGGCAGG - Intergenic
1196714677 X:118799342-118799364 GCGCACAGTGCAGGACTGGCAGG + Intergenic
1199175604 X:144784004-144784026 GCGCACAGCGCGGGACTGGCAGG + Intergenic
1200550382 Y:4571229-4571251 GCGCACGGTGCGGGACTGGCCGG + Intergenic
1201424316 Y:13831729-13831751 GCTGGCCATGTGGGACTGGCAGG + Intergenic
1201962284 Y:19694713-19694735 TCCAGCAGTGCTGGACTGGATGG + Intergenic