ID: 983373142

View in Genome Browser
Species Human (GRCh38)
Location 4:166890029-166890051
Sequence TTATTCCAATGTAAGACCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 130}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983373142 Original CRISPR TTATTCCAATGTAAGACCTA TGG (reversed) Intronic
906040286 1:42783871-42783893 TGATACCAAAGTCAGACCTAGGG - Intronic
906905479 1:49886089-49886111 TGATTCCTGTGTAAGACCAAGGG - Intronic
909494617 1:76264687-76264709 TTATTCTAATGTGATAACTAAGG - Intronic
909973197 1:82015578-82015600 TTATTCCTATGTCAGAACTGAGG - Intergenic
910014781 1:82508327-82508349 TTATTACAATGTTAGATCCATGG + Intergenic
910516920 1:88072376-88072398 TTATTCAAATGTATGAACTCTGG + Intergenic
910784153 1:90975875-90975897 TTATTCTAATGTTACACTTAAGG - Intronic
918416591 1:184315345-184315367 CTATTCCATTCTAAGACCCAGGG - Intergenic
921721360 1:218475352-218475374 TTATTCCTATGTAAGACATGAGG - Intergenic
924701137 1:246453969-246453991 CTATTCCACTTTAAGGCCTAAGG + Intronic
1064605028 10:17030208-17030230 ATATTACAATGTAAGACTAATGG + Intronic
1064716738 10:18184145-18184167 TTACCCCAATGCCAGACCTATGG + Intronic
1065457295 10:25920457-25920479 TTATCCCCATGTTAGACATAAGG - Intergenic
1066817435 10:39437282-39437304 TTTTTCCAATATAGGACCCAAGG + Intergenic
1067365442 10:45623842-45623864 TCATTCCTATGTAAGGCCCAAGG - Intronic
1078749237 11:14144050-14144072 TTTTTCAAATGTAAAATCTAAGG - Intronic
1082087195 11:48059694-48059716 TTGTCCCAGAGTAAGACCTATGG - Intronic
1086052675 11:82612485-82612507 TTAATTCAATGTAAAACATATGG - Intergenic
1087062971 11:94000220-94000242 TTATTCCAATTTTACAACTAAGG + Intergenic
1087948331 11:104192673-104192695 TCATTGCAACGTAAGACCAAAGG - Intergenic
1089409055 11:118223239-118223261 TTATTTCAGTGTTCGACCTATGG - Intronic
1093601021 12:21023032-21023054 TTATTCCAAAGGTAGACCTAAGG - Intronic
1097133644 12:56833553-56833575 TTATTCCAATGTTTGATTTATGG + Intergenic
1099350039 12:81555328-81555350 TTGTCCCAATTTAAGACATATGG + Intronic
1099434276 12:82624972-82624994 TTACTCCCATCTAAGACCAAAGG - Intergenic
1103129105 12:118451452-118451474 TTATTACAATGTTAGACATTTGG - Intergenic
1103859513 12:124001092-124001114 TTATTCAAATAAAAGACCTGGGG + Intronic
1105277787 13:18945757-18945779 TTAATACAATGAAAGCCCTAGGG - Intergenic
1106695844 13:32171712-32171734 TTATGCCAGTGGAAGAACTAAGG - Intronic
1106721367 13:32438222-32438244 TTATTCCATTGTACAAGCTATGG - Intronic
1106879807 13:34116839-34116861 TTATGCAAATGTAACACCTCAGG + Intergenic
1108846002 13:54679085-54679107 TTATTCCATTGCAAAACCTAAGG + Intergenic
1109874948 13:68388807-68388829 ATATTTCAATGTAAGAAGTATGG - Intergenic
1112723046 13:102267866-102267888 TTATTCAAATGTATTATCTAAGG + Intronic
1115762286 14:36586903-36586925 TTATACCATTGTAAGGCATAAGG - Intergenic
1116305346 14:43246672-43246694 TTATACCATTGTAACGCCTAAGG - Intergenic
1117896716 14:60495121-60495143 CTGTTCCAATGTAAGATCTATGG - Intronic
1123478117 15:20606082-20606104 TTATTCCAATGTTCAACTTATGG - Intergenic
1123639898 15:22394302-22394324 TTATTCCAATGTTCAACTTATGG + Intergenic
1126397618 15:48235736-48235758 TTATTCCACTGGATGGCCTACGG - Intronic
1127046856 15:55035197-55035219 TTATCCCAATCTAAGACAAATGG + Intergenic
1127910657 15:63413439-63413461 TTAATACAAAGTAAGAACTAGGG - Intergenic
1131600011 15:93837646-93837668 CTCTTCCAATTTAAGACCTCAGG - Intergenic
1131652204 15:94412316-94412338 TTACTCAAATGTAAGACCTGAGG - Intronic
1132379004 15:101353092-101353114 TTATTACATTGTAAAACATAAGG + Intronic
1133720318 16:8488694-8488716 CTATTCCCTTGTAAGACCTGTGG - Intergenic
1133843800 16:9435847-9435869 TGTTTCTTATGTAAGACCTATGG + Intergenic
1135167968 16:20157181-20157203 CCATTCCAATGTAAGATCTGTGG + Intergenic
1138382958 16:56616573-56616595 TTTTTCCAATGGAAAAACTAAGG - Intergenic
1139813584 16:69646072-69646094 ATTTTCCAATGTAAGAACAATGG - Intronic
1143809648 17:9460874-9460896 TTATTCCCATGTAACAGCTGGGG - Intronic
1143930940 17:10423485-10423507 TTATTACAATCTTAAACCTACGG - Intergenic
1145831513 17:27920255-27920277 TAATTCCAATGTAACAGGTATGG + Intergenic
1146495847 17:33321536-33321558 TTATTCCTATGTAGTACCTCTGG + Intronic
1147513766 17:41096860-41096882 TGATTCCAAAGTAAGACTTCAGG - Intronic
1147515863 17:41117059-41117081 TGATTCCAAAGTAAGACTTCAGG - Intergenic
1149930251 17:60745226-60745248 TAATTTCAATGTAAGTTCTATGG + Intronic
1153736313 18:8072159-8072181 TTATTTCATTTAAAGACCTAAGG - Intronic
1158434278 18:57424148-57424170 TTATTCCCATCTAAGAACTTAGG - Intergenic
1165283459 19:34817222-34817244 TTCTTCTCATGTAAGACTTAGGG + Intergenic
925155395 2:1645584-1645606 TTATTCTACGGTAAGACCAATGG - Intronic
925496687 2:4458194-4458216 TTTTTCCCATGTAAAACATATGG - Intergenic
928672424 2:33615414-33615436 TTATTCTAATGTTTAACCTATGG - Intergenic
930159276 2:48137756-48137778 TTATTCCCATGTAGGACTTTTGG - Intergenic
930341925 2:50127768-50127790 TTATCACAATTTAAGACTTAGGG - Intronic
930774076 2:55155408-55155430 TGTTTCCATTGGAAGACCTAGGG + Intergenic
933361183 2:81286882-81286904 AGATTTAAATGTAAGACCTATGG - Intergenic
933553611 2:83806019-83806041 TTGTTCTATTGTAAGTCCTAGGG - Intergenic
934566255 2:95343195-95343217 ATATTCCAAGGTAAGAGCCAGGG + Intronic
941875848 2:170432259-170432281 TTATCCCACTGTAAGGTCTATGG - Intronic
942995060 2:182250795-182250817 TTTCTCCAAGGTAAGACCTACGG + Intronic
943554819 2:189389577-189389599 TTATTCCAATCTAAAATTTATGG - Intergenic
944377638 2:199065813-199065835 TTATTGCTATTTAAGAGCTATGG + Intergenic
945836011 2:214836471-214836493 TTATTCCAGTGCAACACTTAAGG + Intergenic
946012999 2:216581523-216581545 TTATTCCAATTTTACACATAGGG - Intergenic
946758585 2:222971408-222971430 TTATTCCACTGTCAGAACTCAGG - Intergenic
946963801 2:225014593-225014615 TTATTCCAATCAAACACATATGG - Intronic
1169698168 20:8415429-8415451 GGATTCCAAATTAAGACCTATGG - Intronic
1170391147 20:15876126-15876148 TTATTACACTGTAAGTTCTAGGG + Intronic
1180504044 22:15974085-15974107 TTTATGCAATGTGAGACCTATGG + Intergenic
1184591621 22:45487683-45487705 TTATTTCAATGTTCAACCTATGG - Intergenic
1203334533 22_KI270739v1_random:48427-48449 TTTATGCAATGTGAGACCTATGG - Intergenic
949999307 3:9644345-9644367 TTATTACACTCTAAGATCTAGGG - Intergenic
953590147 3:44243404-44243426 TTATACCAAAGTAAAACCAATGG + Exonic
956740720 3:72273704-72273726 TTTTTCCCTTGTAAGACCTGAGG + Intergenic
957468259 3:80623304-80623326 TTCTTCAAAAGTAAGGCCTAGGG - Intergenic
958668339 3:97169740-97169762 TTATTCAAATGAAAAAACTAAGG - Intronic
960206219 3:114902999-114903021 TTATTCCAATGTGAGGTCAATGG + Intronic
960383896 3:116996171-116996193 GTAGTCCAATCTAAGACCGATGG + Intronic
963431213 3:145206634-145206656 TTAATCAAATGTAAGACACAGGG - Intergenic
965946611 3:174249889-174249911 TTGTTCCAATGTGTGACCTCTGG + Intronic
967376810 3:188813245-188813267 TTATTGCAATGAAATAGCTAAGG - Intronic
972986904 4:44775809-44775831 TTATTCCAATGTTAAATTTATGG - Intergenic
975210091 4:71689885-71689907 ATGTACCAATATAAGACCTATGG + Intergenic
975515776 4:75246182-75246204 TTATTCTACTTTAAGTCCTAGGG - Intergenic
976237905 4:82920245-82920267 TTAGTCAAATGTAACACCAAAGG - Intronic
977426000 4:96867872-96867894 AGATTTAAATGTAAGACCTAAGG + Intergenic
979153640 4:117354239-117354261 TTCTTTCATTGTAAGACCTTTGG - Intergenic
979968289 4:127103946-127103968 ATACGCCAATGTATGACCTATGG + Intergenic
981872202 4:149499855-149499877 TTATTCCAATATTAGAGCCAAGG + Intergenic
983373142 4:166890029-166890051 TTATTCCAATGTAAGACCTATGG - Intronic
984246300 4:177278813-177278835 TGATTCCAATGAAAGGCTTAGGG - Intergenic
985183614 4:187292391-187292413 TTATCCCAGTGTAGGACTTAGGG - Intergenic
990872393 5:60446756-60446778 TTAGTCTAATGTAACACCTCTGG + Intronic
992741049 5:79774073-79774095 CGATTCCAATTTAAGACCAAAGG + Intronic
993571470 5:89544872-89544894 TTATTCAAATGGAAAAACTAAGG + Intergenic
994467818 5:100161265-100161287 TTATTCCAATGTTAAATTTATGG + Intergenic
999036449 5:148356877-148356899 TTACTCCAAAGTATGACCTAAGG - Intergenic
1000882424 5:166713694-166713716 TTCTTTCAATGTAAGACCTAGGG + Intergenic
1008907024 6:56689690-56689712 TTATTCTAATGTAATAGATAAGG - Intronic
1012557728 6:100536288-100536310 TTATTTCAATCTAAGACCAAAGG - Intronic
1015532819 6:134237883-134237905 TTATTCTAATTTAAATCCTATGG - Intronic
1016044224 6:139464867-139464889 GTATTCCTATGTAAAACATATGG - Intergenic
1017912284 6:158804016-158804038 TCATTTCATTGTCAGACCTATGG - Intronic
1018347254 6:162913057-162913079 TTGTTCCAATGTAAGCCTTTAGG + Intronic
1020984308 7:15113271-15113293 TTATACCAATGTATGAACTGTGG + Intergenic
1021005018 7:15383596-15383618 TAATTTCAATATAAGACCTATGG - Intronic
1022856115 7:34316158-34316180 CTATTCCAAAGTAAGCCCTGGGG - Intergenic
1024404199 7:48959386-48959408 TCATTCAAATGTAAGATCAATGG - Intergenic
1030632906 7:111914810-111914832 TTATTACAAAGTAAGTCCTATGG + Intronic
1031025864 7:116679276-116679298 TTATTCCAAGGTATGACAGATGG - Intronic
1035271073 7:157720332-157720354 TCATTCCAATGTCCGACCTCTGG + Intronic
1036455328 8:8901858-8901880 TTAGTCCAGTGAAAGACCAACGG + Intergenic
1036766879 8:11555000-11555022 TTATCCCAAAGTTAGGCCTAAGG + Intronic
1037791049 8:21942070-21942092 GTATTGCAATGTATGACCAATGG - Intronic
1039344060 8:36684517-36684539 TTGTTCCAATGTAAGATCTCAGG + Intergenic
1043542085 8:81275530-81275552 TTAATCCAAAGTAAGAAGTAGGG + Intergenic
1046853567 8:119003738-119003760 TTATTCCAATTTTAGAGATAAGG - Intronic
1047896306 8:129369915-129369937 TTATTCCACTGTAAAAACCATGG - Intergenic
1049506135 8:142999895-142999917 TTATTTCAATGTTCAACCTACGG + Intergenic
1050304010 9:4288084-4288106 TTTTACCAATGTAAGAACTGAGG - Intronic
1052548569 9:29915086-29915108 TTATTAAAGTCTAAGACCTATGG + Intergenic
1055675701 9:78658039-78658061 TTTTTCAAATGTGAGACTTAAGG - Intergenic
1059287086 9:113183342-113183364 TGATTCCCATATAAGACCTAAGG - Intronic
1059380047 9:113916191-113916213 TGATTCCATTGTATGACCCAGGG + Intronic
1060388874 9:123261019-123261041 TTATTCCTATTTCAGACTTAAGG + Intronic
1060918701 9:127405849-127405871 CTCTTCCCATGTAAGACCTTAGG - Intronic
1185837273 X:3356742-3356764 TTATTCCATTGTAATATATAAGG + Intergenic
1187896613 X:23987795-23987817 TTCTTACAATGTTAGACCAATGG + Exonic
1188275899 X:28199884-28199906 ATATTCCAATGGATTACCTAAGG + Intergenic
1194773082 X:97928694-97928716 TTATTGCAATGTCCGACCCATGG + Intergenic
1195219741 X:102735326-102735348 TTATTCCAATGTTCAACTTACGG + Intronic
1195558877 X:106260368-106260390 TTATTCCAATGTTCAACTTATGG + Intergenic
1195599927 X:106734566-106734588 TTATTCCCAGGAAATACCTATGG - Intronic
1197994844 X:132361993-132362015 TTGTTCCAGTGTAAGTCCTAGGG - Intergenic