ID: 983375525

View in Genome Browser
Species Human (GRCh38)
Location 4:166922623-166922645
Sequence TTAGAGAAACAGCATAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 421
Summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 385}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983375525_983375527 -10 Left 983375525 4:166922623-166922645 CCTTCCTTATGCTGTTTCTCTAA 0: 1
1: 0
2: 0
3: 35
4: 385
Right 983375527 4:166922636-166922658 GTTTCTCTAATTCTGAAGTTTGG 0: 1
1: 0
2: 3
3: 36
4: 734
983375525_983375529 0 Left 983375525 4:166922623-166922645 CCTTCCTTATGCTGTTTCTCTAA 0: 1
1: 0
2: 0
3: 35
4: 385
Right 983375529 4:166922646-166922668 TTCTGAAGTTTGGGAGATTATGG 0: 1
1: 0
2: 0
3: 23
4: 329
983375525_983375528 -9 Left 983375525 4:166922623-166922645 CCTTCCTTATGCTGTTTCTCTAA 0: 1
1: 0
2: 0
3: 35
4: 385
Right 983375528 4:166922637-166922659 TTTCTCTAATTCTGAAGTTTGGG 0: 1
1: 0
2: 2
3: 61
4: 725
983375525_983375530 18 Left 983375525 4:166922623-166922645 CCTTCCTTATGCTGTTTCTCTAA 0: 1
1: 0
2: 0
3: 35
4: 385
Right 983375530 4:166922664-166922686 TATGGACCCACTTAGAGCAAAGG 0: 1
1: 0
2: 1
3: 5
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983375525 Original CRISPR TTAGAGAAACAGCATAAGGA AGG (reversed) Intronic
900962041 1:5929567-5929589 TTATAGTAACAGCCTAAAGAAGG - Intronic
903604189 1:24562921-24562943 CTGGAGAAAGGGCATAAGGAGGG - Intronic
904111190 1:28127886-28127908 TTAAAGAGACAGCCTGAGGAAGG - Intergenic
905156797 1:35991004-35991026 TTAGAAAAACAGTATAAGGCTGG + Intronic
906575287 1:46884055-46884077 GTAGAGAAAGAGCATGAGGTAGG + Intergenic
906736951 1:48138536-48138558 TAAGAAAAAAAGCCTAAGGAGGG - Intergenic
906816490 1:48885627-48885649 CAAGAGAAACAGCAGAAGAAAGG - Intronic
907639602 1:56173681-56173703 TTAGAGACCCAGAAAAAGGAGGG - Intergenic
907813352 1:57894200-57894222 TTAGAGCAAGAACAAAAGGAAGG - Intronic
908492390 1:64659120-64659142 TGAGAAAAACAGGACAAGGAAGG + Intronic
908706775 1:66965838-66965860 ATGGAGATACAGCAGAAGGATGG - Intronic
909524714 1:76610029-76610051 TAAGAGAAACAGCCAAAAGAAGG - Intronic
910874980 1:91870193-91870215 TTTGAGGAATAGCATAAAGATGG - Intronic
911288097 1:96022716-96022738 TTAGAGATAAAGCATAAAGTAGG - Intergenic
911635670 1:100232810-100232832 TGACAGAAATAGCAAAAGGAAGG + Intronic
912769345 1:112448780-112448802 CTAAAGAAACAGCATTAGAAAGG - Intronic
913385611 1:118255326-118255348 TTTGAGAAAAAGCAAAATGATGG + Intergenic
914340471 1:146755769-146755791 TTAGAGAAACATTATGGGGATGG + Intergenic
915368023 1:155326176-155326198 GTAGAGGAACAGCATAAGCAGGG - Intronic
915864097 1:159479412-159479434 TTAATGAAACAGTAAAAGGAGGG + Intergenic
915897941 1:159825847-159825869 GAAGAGAAACAGGATGAGGAGGG + Intergenic
916536070 1:165704421-165704443 TTAAAGGAACAGCACAAGGCCGG - Intergenic
916681571 1:167109567-167109589 GTAGAGAAAGACCATAAGGTGGG - Intronic
917273936 1:173310127-173310149 CTAGTGAAACAGCAAAAGAAAGG - Intergenic
917566655 1:176219314-176219336 AGAGAGAAACAGCCTAAGAATGG - Intergenic
918140562 1:181716193-181716215 TTTGAGAAGCACCACAAGGAGGG + Intronic
918972140 1:191433259-191433281 TTAGAGAAAAACCATCAGGTGGG - Intergenic
919463704 1:197908343-197908365 TTAGAGCACCAGCAAAAGTAGGG - Intergenic
920919135 1:210283741-210283763 TTAGAGAAACAGAGTTAGGCTGG - Intergenic
921137113 1:212271494-212271516 TAAGGGAAACAGCATGAGCAAGG - Intergenic
921427315 1:215019399-215019421 CTAGAGAAACACCATGAGCAGGG + Intronic
923539263 1:234876343-234876365 TTAGAGAAACTGGATAAGCCCGG - Intergenic
924104574 1:240637401-240637423 TAAGAAAAACAGTATTAGGATGG - Intergenic
1063287913 10:4710542-4710564 TTAGTGATAAAGCAGAAGGATGG - Intergenic
1064019686 10:11799167-11799189 CAAGAGAGAGAGCATAAGGAAGG - Intergenic
1064227204 10:13497629-13497651 TGAGAGAAACAGAATAAGATAGG - Intronic
1065628959 10:27658480-27658502 TAAGAAAAACATCATTAGGAAGG - Intergenic
1065822347 10:29537449-29537471 TTAGAGAAACATCATGGGTAAGG + Intronic
1066609345 10:37222656-37222678 ATGGAGGAACAGCATGAGGAAGG - Intronic
1067044869 10:42979899-42979921 TGTGAGAAGCAGCATGAGGAGGG + Intergenic
1068808555 10:61228250-61228272 GTAGAGAAACACCATCAGGTTGG - Intergenic
1070090204 10:73277296-73277318 TTTGAGAAACACCATAATGAAGG + Exonic
1070815740 10:79321949-79321971 TGAGAGAAGCAGAGTAAGGAGGG - Intergenic
1072326561 10:94304659-94304681 CTAGAGAAAGAACATAAGGTCGG + Intronic
1072466142 10:95664100-95664122 TAAGAGGCACAGGATAAGGATGG + Exonic
1072849396 10:98871712-98871734 GCAGAAAAACAGCCTAAGGAAGG + Intronic
1073624403 10:105081968-105081990 TTAGATAAACTTCATAAGCATGG - Intronic
1073660422 10:105470067-105470089 TTCAAGAGACAGCAAAAGGAAGG - Intergenic
1074305131 10:112269972-112269994 TAATAACAACAGCATAAGGAAGG + Intergenic
1075371193 10:121936572-121936594 TTAGATTAAAAGCAGAAGGATGG + Intergenic
1075414678 10:122253567-122253589 TTTGAGATGTAGCATAAGGAGGG - Intronic
1077587652 11:3466244-3466266 TTTGAGAAAGAGAAAAAGGAAGG - Intergenic
1078008063 11:7547438-7547460 TTAGAGAAAGAGCAGTGGGAAGG + Intronic
1078283470 11:9926381-9926403 GTAGGGAAAAAGCAAAAGGATGG + Intronic
1078363360 11:10687345-10687367 CTAGAGAAACAGAAGAGGGAGGG - Intronic
1078846353 11:15122276-15122298 TTAGACAGACAGCATGAGGTGGG + Intronic
1079339429 11:19599777-19599799 TTTGAGAAACAGCATGAGGGAGG + Intronic
1079551239 11:21701014-21701036 TTAAAGAAACAGGACAATGAAGG + Intergenic
1079792904 11:24761339-24761361 TTATAAAAACAGCAGTAGGATGG + Intronic
1080446437 11:32342051-32342073 TTAGAGGAACAGTAGAATGAAGG - Intergenic
1081023844 11:37983454-37983476 ATAGAGAAACGGCATAGGGTAGG - Intergenic
1084079962 11:66815901-66815923 ATAGAGAAACAGGTTCAGGAGGG + Intronic
1084243354 11:67837911-67837933 TTTGAGAAAGAGAAAAAGGAAGG - Intergenic
1084829345 11:71756676-71756698 TTTGAGAAAGAGAAAAAGGAAGG + Intergenic
1085382679 11:76134541-76134563 TAAGAGAAACAGTAAAGGGAAGG + Intronic
1085485224 11:76858048-76858070 TTAGAAAAAAAGAAAAAGGAAGG + Intergenic
1085791014 11:79497896-79497918 TTAGAGAAAGAGCAGAGGGTGGG + Intergenic
1087193251 11:95278774-95278796 TGAGAGAAGCAGAATGAGGAGGG + Intergenic
1087311037 11:96543669-96543691 TTAGGGAAACAGTATTAGGGTGG + Intergenic
1087845780 11:102971035-102971057 TTAGGGAAACACCAACAGGAAGG + Intergenic
1088409580 11:109519684-109519706 TTAGAGAAACAGGATAAACTGGG + Intergenic
1088859241 11:113784412-113784434 TTAGAGAAAGAGTTTGAGGAAGG + Intergenic
1089000314 11:115046344-115046366 CTAGAGAAACAGCACTAGTAAGG + Intergenic
1089127575 11:116187743-116187765 TGATAGAAACGGCATAATGAAGG + Intergenic
1089968021 11:122669949-122669971 TTTGATGAACAGCAGAAGGAAGG + Intronic
1090587593 11:128231375-128231397 TTAAAGAAATAGCATAGAGATGG + Intergenic
1091929183 12:4381106-4381128 TTGGAGAAGCAGCCTAGGGAAGG - Intergenic
1092191451 12:6524249-6524271 TTAGAGAATCAGAGCAAGGAGGG + Intronic
1092413897 12:8275013-8275035 TTTGAGAAAGAGAAAAAGGAAGG - Intergenic
1093594557 12:20945289-20945311 GTAGAGAAAAACCATAATGAGGG - Intergenic
1093912323 12:24762143-24762165 GTAGAGAAGCAGCACTAGGATGG - Intergenic
1094004944 12:25739276-25739298 TTAGAAAAACAGTATAAGCCAGG + Intergenic
1095726730 12:45461939-45461961 TTAGAAAAGCAGCAAAAGGAAGG - Intergenic
1095918991 12:47510104-47510126 AGATAGAAACAGCAGAAGGAAGG - Intergenic
1097575919 12:61392252-61392274 TTATAGAAACAACAGAAGGAAGG + Intergenic
1097978471 12:65712673-65712695 TTAAAGAGACAGCATAGGCAGGG + Intergenic
1098168738 12:67723961-67723983 TGAGAGATACAGGATTAGGACGG + Intergenic
1099025374 12:77459130-77459152 TAAGAGAAAAATCAGAAGGAAGG + Intergenic
1099629277 12:85120076-85120098 TTAGATAAAATGCAAAAGGAAGG - Intronic
1100775533 12:97969112-97969134 TTAAGGAAACAGCATAAAGTGGG + Intergenic
1103045097 12:117729569-117729591 TGAGAGAAACTTCATAATGAGGG - Intronic
1103428580 12:120861349-120861371 CTAGAAAAACAGAAAAAGGAAGG + Intronic
1105351962 13:19623925-19623947 TTACATAAACAGCAAAAGGAAGG - Intergenic
1107040183 13:35939690-35939712 TTAAAGAAACAGTATAGGGCCGG - Intronic
1108971742 13:56384434-56384456 TAAGAGAACTAGCAAAAGGATGG - Intergenic
1109586108 13:64406991-64407013 TCAGAGAATTAGGATAAGGAAGG + Intergenic
1110048815 13:70867662-70867684 TGTAAGAATCAGCATAAGGATGG - Intergenic
1111784696 13:92771638-92771660 TTAGAAAAACTGGATAAGGGCGG - Intronic
1112042266 13:95558391-95558413 TTAGCAAAACAGGATAATGAAGG - Intronic
1113039770 13:106092129-106092151 TTAGGGAGTCAGTATAAGGAGGG - Intergenic
1113245138 13:108386798-108386820 AGAGAGAATCAGAATAAGGATGG - Intergenic
1113325901 13:109280935-109280957 TTAGAGAAACAGAATAAACAGGG + Intergenic
1114861640 14:26529886-26529908 TTACATAGACAGCAAAAGGAGGG - Intronic
1115438133 14:33400616-33400638 TTAGATAAACAACATAACCAGGG + Intronic
1115670453 14:35605989-35606011 GAAGAGAAAGAGCATCAGGAAGG + Intronic
1115753259 14:36510729-36510751 TTAGAGCAGCAGCATTAGGAGGG + Intronic
1115896190 14:38090360-38090382 TTGGAGAAACAGCAGGAAGAAGG + Intergenic
1117118250 14:52538969-52538991 TTTAAGTTACAGCATAAGGATGG + Intronic
1120806761 14:88759785-88759807 TTAGAGAAAAAGGATAGGGTGGG + Intronic
1121373211 14:93380078-93380100 TTAAAGACACAACATAAGTAAGG + Intronic
1123465707 15:20513546-20513568 TTAGAGAAAATGGAAAAGGAGGG - Intergenic
1123652409 15:22487492-22487514 TTAGAGAAAATGGAAAAGGAGGG + Intergenic
1123742831 15:23296353-23296375 TTAGAGAAAATGGAAAAGGAGGG + Intergenic
1123847738 15:24320496-24320518 GTAAAGAAACTGCATACGGAAGG + Intergenic
1123866779 15:24527873-24527895 GTAAAGAAACTGCATAAAGAAGG + Intergenic
1123894663 15:24816576-24816598 TTATAGCAAGAGCAGAAGGAAGG - Intergenic
1124030657 15:26008241-26008263 AGACAGAAACAGCATAAGAAAGG - Intergenic
1124276431 15:28329523-28329545 TTAGAGAAAATGGAAAAGGAGGG - Intergenic
1124306271 15:28582084-28582106 TTAGAGAAAATGGAAAAGGAGGG + Intergenic
1126296246 15:47139053-47139075 TTAGAGAAAGAGAATCAGCAAGG - Intergenic
1126326112 15:47479333-47479355 ATAGAGAAACAGGTTGAGGATGG - Intronic
1126431314 15:48588004-48588026 CTGGAGAAGCAGCAGAAGGAAGG + Intronic
1126454039 15:48841817-48841839 TTAGAAAGTCAGCATAAAGAGGG + Intronic
1128868323 15:71133280-71133302 TTTCAGAAACAGCAGAAGAATGG + Intronic
1129065089 15:72895877-72895899 TTAGAGGAACAGAGAAAGGAAGG + Intergenic
1130970175 15:88726223-88726245 TTAAAGAAAAGGCATAAGGGTGG - Intergenic
1131769340 15:95718278-95718300 ATAGAGAAAGAGGATAGGGAAGG - Intergenic
1133109040 16:3534690-3534712 TTAGAGAAAGAGAAAAATGAGGG + Intronic
1133355074 16:5130185-5130207 TTTGAGAAAGAGAAAAAGGAAGG - Intergenic
1133911460 16:10070001-10070023 TTAGAGAAACAGAAGTAGGAGGG - Intronic
1133960937 16:10492845-10492867 TCATAGAAACAGCTTAATGAAGG - Intergenic
1134306046 16:13033452-13033474 TTAGAGAAGCAGAAAAAGAAAGG - Intronic
1134686181 16:16160087-16160109 TTAGAGGAACAGCAAGAAGACGG - Intronic
1134841419 16:17405022-17405044 TTAGAAAAACAGCATTTAGAGGG + Intronic
1135981836 16:27153870-27153892 GTAGGGAAAGAGAATAAGGAGGG + Intergenic
1137353974 16:47740294-47740316 TGGGAGAAATAGCAGAAGGAAGG - Intergenic
1138869378 16:60863213-60863235 TTTGAGAAACAGCAGATGCAAGG - Intergenic
1139432253 16:66917546-66917568 AAAGAGAAACAGCAAGAGGAAGG + Intronic
1139656450 16:68389935-68389957 TTAGAGAAGAAACAGAAGGATGG + Intronic
1139993816 16:70961637-70961659 TTAGAGAAACATTATGGGGATGG - Intronic
1140275655 16:73506391-73506413 TAAGATAAACAGCATATGGTGGG + Intergenic
1140618425 16:76695843-76695865 TCACATACACAGCATAAGGAAGG + Intergenic
1141085386 16:81091063-81091085 TTAGGGAGGCAGCATAAAGATGG + Intronic
1141330416 16:83105893-83105915 TTAGAGAAACGACACAATGAAGG + Intronic
1141334857 16:83145088-83145110 TTGGAGGAGCAGCATATGGATGG - Intronic
1142732159 17:1867022-1867044 TTCTAGAAAGAGCATAATGATGG - Intronic
1142858334 17:2745911-2745933 TCAGAGAACCAGAAGAAGGAGGG - Intergenic
1143134731 17:4705564-4705586 TTTAAAAAACAGCATAAAGAAGG - Intergenic
1144006606 17:11106082-11106104 TGAGTGAAACAGGATGAGGAGGG - Intergenic
1144317432 17:14076047-14076069 TCAGGCAAACAGCATAGGGAGGG - Intronic
1144392885 17:14812557-14812579 TGAGCGAAACAGCCTGAGGACGG - Intergenic
1144630384 17:16869053-16869075 TGAGAGAAACACCCTAGGGATGG - Intergenic
1145116896 17:20218620-20218642 TTAGAAAAAAAGAATAAGGGAGG - Intronic
1145775218 17:27522981-27523003 TTAGAAATACAGCATGGGGAGGG + Intronic
1146679956 17:34799919-34799941 TTAGAGAACAAGCAGGAGGAAGG - Intergenic
1148767805 17:50049423-50049445 GTGGAGAAACAGCAAAAGGCTGG + Intergenic
1149116393 17:53102044-53102066 TCAGAGACAAAGCATCAGGATGG - Intergenic
1150882281 17:69043761-69043783 TTAGAGAAAAAGCCTAAGGTTGG - Intronic
1152563014 17:81087973-81087995 TCACAGAAACAGCTTGAGGACGG - Intronic
1153483713 18:5574144-5574166 TTAGAGAAATAGAATAGAGAGGG - Intronic
1154018346 18:10639645-10639667 TTGGAGGAACAGCATAATGGTGG - Intergenic
1154395819 18:13987619-13987641 GTAGAGAAAGACCATGAGGATGG + Intergenic
1155751068 18:29422834-29422856 TTAGGCAAGCAGCATTAGGATGG - Intergenic
1156554798 18:38054996-38055018 AAAGAGAAACAGAATTAGGAAGG - Intergenic
1157230449 18:45910974-45910996 TTAGAGGTACAGCATAAAGATGG + Intronic
1158378591 18:56902824-56902846 TTACTGCAGCAGCATAAGGAAGG + Intronic
1158639542 18:59191871-59191893 TAAGAGAAGCAGGATAAGAAAGG - Intergenic
1158799699 18:60891949-60891971 CTAAAGAAACAGAATAAGCAGGG + Intergenic
1159116489 18:64119242-64119264 TTAGAGGAAGAACAGAAGGAAGG + Intergenic
1159710947 18:71758834-71758856 ATAGGGAAACAATATAAGGAGGG - Intronic
1159771929 18:72556437-72556459 TGAAAGAAAGAGCAGAAGGAAGG + Intronic
1160839753 19:1140805-1140827 TGAGAGAAACAGGAAATGGATGG + Intronic
1162855695 19:13466818-13466840 TTAGAGAAGCATGATATGGACGG + Intronic
1163051918 19:14690465-14690487 TTAGGGAAAGTGCATAAAGACGG + Intronic
1164293243 19:23886368-23886390 TTAGGCAAACAGCATTAGAAGGG - Intergenic
1168209039 19:54875668-54875690 AAATAGAATCAGCATAAGGAAGG - Intronic
925818883 2:7779586-7779608 TTAGAGAAACAGAACCAGTAGGG - Intergenic
926351711 2:12001306-12001328 TTAGACAAAAATCATAAGGGTGG + Intergenic
927438961 2:23096360-23096382 TTAGAAAAACACAATAAGGATGG + Intergenic
927876059 2:26655856-26655878 TTTAAGAAACAGCAAAAGGAAGG - Intergenic
927997635 2:27497061-27497083 TTAGGGAAAGAACATCAGGAAGG - Intronic
928785543 2:34881207-34881229 TTAAAGAAGGAGCAAAAGGAAGG - Intergenic
928804687 2:35136522-35136544 TCACAGAAACAGTAGAAGGAAGG - Intergenic
928896792 2:36275134-36275156 TTATAGAAACAGCATTACCAGGG + Intergenic
930519116 2:52440969-52440991 TCAGTGAAACAGCATTTGGATGG - Intergenic
931472689 2:62555051-62555073 TTAGAAAAACATCACCAGGAAGG + Intergenic
932813344 2:74842731-74842753 TTAGAGGAAGAGCTTAAGGATGG - Intronic
932889929 2:75585141-75585163 TAACAGAAACAGCATAATGCTGG + Intergenic
933126001 2:78606907-78606929 TTAGAGAAAAAAAATGAGGAAGG + Intergenic
933265234 2:80174437-80174459 TTGGAAAAACAGCCCAAGGAAGG - Intronic
933936380 2:87207222-87207244 TTAGAGAAGGAACAAAAGGAAGG + Intergenic
934104904 2:88686550-88686572 TTAGAGAAAGAACAAAAGGAAGG - Intergenic
936356769 2:111758607-111758629 TTAGAGAAGGAACAAAAGGAAGG - Intergenic
937481762 2:122268951-122268973 TTAGAGGAAAAGATTAAGGAAGG + Intergenic
937571045 2:123362005-123362027 TCAGAGATAAAGCATAAGGCAGG + Intergenic
937776553 2:125783746-125783768 GTAGAGAAACCACATAAAGATGG + Intergenic
937782431 2:125854434-125854456 ATAGAGAAACGGCACAAGGTTGG + Intergenic
938086306 2:128404398-128404420 TGAGAGACACAGCAGATGGAGGG - Intergenic
938591014 2:132736263-132736285 TTAAAGAAACTACATAAAGATGG - Intronic
939126413 2:138182993-138183015 TCTGAGAAACAGCCTAAAGATGG + Intergenic
939338887 2:140867737-140867759 ATAGAGACACAGCAAAGGGATGG + Exonic
940438320 2:153681946-153681968 TAGGAGAAACAGCTTAAAGATGG - Intergenic
940483202 2:154262763-154262785 TTAAAGAAAAAATATAAGGAAGG + Intronic
940893794 2:159061307-159061329 TAAGAGAAACTGCAGAAGAAAGG + Intronic
942531777 2:176917913-176917935 TAAGACAAACAACATAAGAATGG + Intergenic
943626803 2:190210404-190210426 GTAGAGAAAGAGCAGTAGGAAGG - Intronic
943710550 2:191090287-191090309 TGAGAGGAATAGCATAAGGAGGG - Intronic
944207443 2:197171521-197171543 TCAGTGAAACAGGAGAAGGAAGG + Intronic
944490519 2:200253865-200253887 TGAGAGAAACAGGACAGGGATGG - Intergenic
945454227 2:210031416-210031438 TGAGTGAAACAGCATTAGGTAGG - Exonic
945573492 2:211501204-211501226 TAAAATAAACAGCATAAGAAGGG + Intronic
946605522 2:221399971-221399993 TTAGACAAGCACCACAAGGAGGG - Intergenic
946849418 2:223890571-223890593 TTAGATAATAAGTATAAGGATGG - Intronic
948608632 2:239152698-239152720 TTAGAGAAGGACCACAAGGATGG - Intronic
948714806 2:239854189-239854211 TCAGAGACACAGCAAAGGGAGGG - Intergenic
1168936833 20:1672983-1673005 TTAGAGAATCAGAAAAATGAAGG + Intergenic
1168954229 20:1823639-1823661 TTAGAGAAACAGCAGGTGGTAGG - Intergenic
1170611965 20:17921886-17921908 TTAGAGAAATGGGTTAAGGAGGG + Intergenic
1170789345 20:19494948-19494970 TGAGAGAAACAGGATCAGGCAGG + Intronic
1171316397 20:24199508-24199530 GCAGAGAAACAGGATAGGGAAGG - Intergenic
1171365503 20:24620271-24620293 TTCAAGAAGCAGCATGAGGATGG + Intronic
1172367364 20:34360331-34360353 CTAGAGAAACTGAATGAGGATGG + Intergenic
1173037190 20:39423680-39423702 AAAGAGACACAGCACAAGGAGGG - Intergenic
1173256833 20:41399743-41399765 CTGGAAAAACAGGATAAGGAAGG - Intergenic
1175052190 20:56166138-56166160 AGACAGAAACAGGATAAGGAAGG + Intergenic
1175355978 20:58368520-58368542 TTAGAGAAGGAGCACAAGGTGGG - Intergenic
1175879575 20:62249467-62249489 TTTAAGAAAAAGCATTAGGAAGG - Intronic
1175921916 20:62454190-62454212 TTAGAGGAACCTCGTAAGGATGG - Intergenic
1178045862 21:28694372-28694394 TGAGAAAAACAACAAAAGGAAGG + Intergenic
1178799440 21:35778857-35778879 TAAGAGAAAGACCCTAAGGATGG - Intronic
1178868168 21:36347876-36347898 TGAGAGAGACAGGATAAGGCTGG + Intronic
1179548613 21:42128548-42128570 ATAGAGAAGCAACACAAGGAAGG + Intronic
1181382138 22:22514283-22514305 TTGGAGGCACAGCAGAAGGAGGG - Exonic
1182051895 22:27318819-27318841 TCTGAGAAACAGCAAGAGGAAGG + Intergenic
1182522471 22:30892183-30892205 TTAGAGGAGGAGCATGAGGAGGG + Intronic
1182595352 22:31415917-31415939 TTAGAGACAAGGCATAATGAAGG - Intronic
949253402 3:2015573-2015595 TTAGAGAAACAGAGTACAGAAGG - Intergenic
950161465 3:10764183-10764205 ATAGAGACACAGCATCATGAAGG - Intergenic
950166600 3:10805434-10805456 TGAGAGAAACATCCTAGGGATGG - Intergenic
950572899 3:13813030-13813052 TTAGAGGAACAGAAGGAGGAGGG + Intergenic
950683069 3:14598529-14598551 GCAGAGAAACAGCATGAGTAAGG - Intergenic
950891270 3:16406777-16406799 TTAGTGAAACAGCATACAGCAGG - Intronic
952595332 3:35010690-35010712 TCAGAGGAACAGCATAATCAGGG - Intergenic
953109443 3:39919386-39919408 TTAGAGATACTGCACAAGAAGGG - Intronic
953600771 3:44361954-44361976 TTTTAGAAGCAGCATAAGGTTGG - Intronic
954424448 3:50435987-50436009 TTAGAGACACAGGGTGAGGAGGG + Intronic
954592611 3:51796510-51796532 TTTGTGCAACAGCAGAAGGAAGG - Intergenic
955894152 3:63681244-63681266 TTTGAAAAACAACATAAAGAAGG + Intergenic
956695328 3:71914038-71914060 TTAGAGACTCAGAATGAGGAGGG - Intergenic
957058925 3:75465836-75465858 TTTGAGAAAGAGAAAAAGGAAGG - Intergenic
957558718 3:81794128-81794150 TTATAGTAAAAGCATAGGGAGGG + Intergenic
957610383 3:82458461-82458483 TTAGGAAAACAGCATGAGGATGG - Intergenic
957950736 3:87122771-87122793 TTAAAAAAACAAAATAAGGAAGG + Intergenic
957991351 3:87631336-87631358 TTAGAAGAAAAGCATTAGGAGGG - Intergenic
958936772 3:100263449-100263471 TGACAGTAACAGCATAAGCAAGG + Intronic
959333410 3:105035226-105035248 TTAGAGAGACAGCTTAAAAACGG + Intergenic
959383664 3:105674488-105674510 TTAGAGAAACAGCAAAATAAAGG + Intronic
960357316 3:116669603-116669625 TTATAGAGACAGCTTAAGGAGGG + Intronic
960533744 3:118794086-118794108 GTAGTGAAACAGCACAAGGAAGG + Intergenic
961119449 3:124361218-124361240 TTAGAAAAAAATCAGAAGGAAGG - Intronic
961891447 3:130133634-130133656 TTTGAGAAAGAGAAAAAGGAAGG - Intergenic
962673735 3:137736236-137736258 TTAGAGAAAGACCATCAGGTAGG + Intergenic
963768218 3:149361088-149361110 ACAGAGAAAAAGAATAAGGAGGG - Intergenic
964903599 3:161691492-161691514 CTAGGGAAACAGCAAAAGCAAGG - Intergenic
965442922 3:168738552-168738574 TTAGAGAAGCAGGACAAGGCAGG + Intergenic
965614899 3:170584590-170584612 CTAGAGAAACAGGAGAAGAAGGG - Intronic
965999437 3:174929415-174929437 TTAGAGGAGGAGAATAAGGAAGG - Intronic
966963290 3:184963112-184963134 TTAAAGAAAAAGAATAAGGAGGG - Intronic
967348128 3:188481560-188481582 TTAGAGAAACAGAGTAAAGAAGG + Intronic
967434153 3:189425232-189425254 TTACCGAAACAGGGTAAGGAAGG - Intergenic
967468148 3:189831672-189831694 TTAGAGAAAGAAGATTAGGAAGG - Intronic
969002842 4:3996060-3996082 TTTGAGAAAGAGAAAAAGGAAGG - Intergenic
969208471 4:5667286-5667308 TTAGAAAACAAGCATAAAGAAGG - Intronic
969751186 4:9112458-9112480 TTTGAGAAAGAGAAAAAGGAAGG + Intergenic
969811092 4:9648751-9648773 TTTGAGAAAGAGAAAAAGGAAGG + Intergenic
969885163 4:10208980-10209002 TCCGAGAAACAGCATTAGAACGG - Intergenic
970896788 4:21112787-21112809 TTAGAAAAACAGAAAATGGAAGG + Intronic
972784320 4:42312854-42312876 TTAGAGAAACAGGTTAAACACGG - Intergenic
973062632 4:45747637-45747659 TTCCAGAAACAGCATAAAGATGG - Intergenic
974381567 4:61147035-61147057 AAAGAGAAAGAGCACAAGGAAGG + Intergenic
976887871 4:90007932-90007954 GTAGAGAAAGAGCATTAGGTGGG - Intergenic
977890320 4:102302584-102302606 GTAGAGCAGCAACATAAGGAAGG + Intronic
979032045 4:115661649-115661671 CTGGATAAACAGCAGAAGGAAGG - Intergenic
979431806 4:120641624-120641646 TGAGAGAAACAGGATAAGGCAGG + Intergenic
979757519 4:124360606-124360628 TTAAAGAAACAAGAGAAGGAGGG + Intergenic
980124050 4:128756508-128756530 TTAAAAAAACAGTATAAGGATGG + Intergenic
980848136 4:138348774-138348796 TTAGAGACACAGAAGGAGGAAGG + Intergenic
981119318 4:141030764-141030786 TTATAGAAACAGAATCAGAATGG + Intronic
981221455 4:142241718-142241740 TTACAGAAACAGCAAAGAGAAGG - Intronic
981712908 4:147726421-147726443 TTAGAAAGAAAGCATAATGAAGG - Intergenic
981976220 4:150731656-150731678 TCAGAGAGACAGTAGAAGGATGG + Intronic
982303934 4:153909028-153909050 CTAGAAAAACTACATAAGGATGG - Intergenic
982385996 4:154803297-154803319 TAAGTGAAAAAGGATAAGGAAGG - Intronic
982950379 4:161687336-161687358 TTAAAGAAATAGTATAAAGATGG - Intronic
982965688 4:161903846-161903868 TCAGAGGAACAGAGTAAGGATGG - Intronic
983366935 4:166803308-166803330 TTTGAGGACCAGCCTAAGGATGG + Intronic
983375525 4:166922623-166922645 TTAGAGAAACAGCATAAGGAAGG - Intronic
983388705 4:167101648-167101670 TTAGAGAATTAGCATATTGAAGG - Intronic
984677620 4:182568374-182568396 TTGGAGAAACAGAATGAGAAGGG + Intronic
986095582 5:4550561-4550583 ACAGAGAAACAGTATTAGGAGGG + Intergenic
986890479 5:12299033-12299055 TTAGGGTAACAGCATAGAGAGGG + Intergenic
987133295 5:14879113-14879135 TTAGGGATACAGGAGAAGGAGGG - Intergenic
987748116 5:22004245-22004267 ACAGAAAAACAGCATGAGGAAGG - Intronic
988312950 5:29585364-29585386 TAAGAGAAACAGTGTAAGAACGG - Intergenic
988445943 5:31286348-31286370 TTAGACCAGCAGCTTAAGGAAGG + Intronic
990361343 5:55023536-55023558 TTAGAGAAACGACATGAGTAGGG + Intergenic
990868321 5:60403754-60403776 CTGGAGAGACAGCATCAGGAAGG - Intronic
990942106 5:61213174-61213196 TGAGAGAAGCAGGATAGGGAAGG + Intergenic
991491772 5:67190819-67190841 TTAGATATACAGCAGAAGGGAGG - Intronic
991654561 5:68891302-68891324 TTAAGGACACAGCAAAAGGAAGG - Intergenic
991933159 5:71775227-71775249 ACAGAGAAAGAGAATAAGGAGGG - Intergenic
992455672 5:76913447-76913469 TCAGACAAACAGAATCAGGAAGG + Intronic
992894970 5:81238036-81238058 TTAGAAAAAGAGAATAAGGCTGG + Intronic
995619525 5:114008727-114008749 TTTGAGAAATAGCATAATTAAGG + Intergenic
995930986 5:117443636-117443658 ATATAGAAAAAGCAAAAGGATGG - Intergenic
996155249 5:120091130-120091152 GCAGAGTAACAGCATATGGAAGG + Intergenic
998325732 5:141278363-141278385 TTAGAAAAGCAGCCTAAGGCTGG + Intergenic
999108634 5:149095489-149095511 GTAGAGAAAGACCATAAGGTTGG - Intergenic
1000655079 5:163867831-163867853 TTAGAAAAACATTTTAAGGAAGG - Intergenic
1002398055 5:178973102-178973124 AGAGAGAGACAGCAAAAGGAAGG - Intergenic
1003792712 6:9565120-9565142 TTGGAGAAAGAAAATAAGGAAGG - Intergenic
1006387940 6:33742369-33742391 TGAGGCAAACAGCATAAAGAGGG - Intronic
1006728527 6:36217668-36217690 TTAAACAAAAAGCAGAAGGATGG + Intronic
1007853467 6:44829129-44829151 TTGGAGGAACAGGAAAAGGAGGG + Exonic
1008108541 6:47467174-47467196 ATAGAGAAAAAGGATAAGAAAGG + Intergenic
1008531165 6:52461018-52461040 TTACAGTAATAGCATAAGAAAGG + Intronic
1008811373 6:55504313-55504335 TTAGAGAAACTTCATAAAGAAGG - Intronic
1008932767 6:56956630-56956652 TTGGAGACACTGCATAAGGTGGG + Intronic
1009903767 6:69842839-69842861 TTAAAAATACAGCATAAGCAAGG - Intergenic
1010017553 6:71122399-71122421 TTAGAGAAATACCATCAGGTGGG + Intergenic
1010027674 6:71238694-71238716 TTAGAGAAAGGGAATAAGGTTGG + Intergenic
1010780896 6:79945427-79945449 TTACACAAACATCATCAGGAAGG + Intronic
1011109058 6:83816216-83816238 GAAGAGAAACATCATAAAGATGG + Intergenic
1011219163 6:85035889-85035911 TTAGAGAAGAAGCTTAGGGAAGG - Intergenic
1011892081 6:92176410-92176432 TCAGAGATACAGCAGAAGAAAGG + Intergenic
1012046425 6:94280916-94280938 TTAGAGAAACAATAAAAGGATGG - Intergenic
1012761417 6:103307882-103307904 TTTGAGAAAAAGCAAAAAGAAGG + Intergenic
1012965633 6:105669751-105669773 GTAGAGAAAAACCATAAGGCTGG - Intergenic
1013659412 6:112279641-112279663 TTGGAGAAACAGCTAAAGCAAGG + Intergenic
1014290856 6:119556524-119556546 CTCCAGAAAGAGCATAAGGATGG + Intergenic
1014347310 6:120289388-120289410 TTGAAGAAAGAGCATAAGTAGGG - Intergenic
1014537352 6:122630489-122630511 TTATAGAAACAGTAAAATGATGG + Intronic
1016516082 6:144894422-144894444 TTACTGAATCAGCAAAAGGATGG - Intergenic
1016687207 6:146895235-146895257 TTATAGATACAGGATAAGAAAGG + Intergenic
1018550908 6:164997801-164997823 TTTAAGAAAAAGCAAAAGGAAGG - Intergenic
1020321787 7:6944181-6944203 TTTGAGAAAGAGAAAAAGGAAGG - Intergenic
1021153582 7:17181708-17181730 TCAGAGACACAGGATAAGGAAGG - Intergenic
1022756027 7:33291424-33291446 TGGGAGAAATAACATAAGGAAGG - Intronic
1022778756 7:33556455-33556477 TTTGAGAAACAGTATAAAGAAGG - Intronic
1022789107 7:33669054-33669076 TTAGTGGAACAGGAAAAGGAAGG + Intergenic
1023475633 7:40574909-40574931 ATACAGAAACAGCAGAAAGAGGG + Intronic
1023533616 7:41184386-41184408 TTAGAGGAAAAGTATAAGTATGG + Intergenic
1023634163 7:42193141-42193163 CTAGAGAAACAGCTCAAGGAAGG + Intronic
1024163599 7:46706714-46706736 TTAAGGAAACAGAATAAGCAGGG + Intronic
1025910779 7:65826700-65826722 ATAGAGGATCAGCATAATGAGGG - Intergenic
1026104136 7:67407740-67407762 TTAGAGAAAGAGCTTCAGGAAGG - Intergenic
1026808332 7:73442051-73442073 TTAGAAAAACAGCATAAGCTTGG + Intronic
1027744478 7:82056335-82056357 TTGGAGAAGCAACATGAGGATGG + Intronic
1027813045 7:82930298-82930320 AGGGAGAAACAGCATTAGGAGGG + Intronic
1027948047 7:84776510-84776532 TTATAGAAACAGTAGAAGGTTGG - Intergenic
1028542433 7:91957858-91957880 TTATGGAAACAAAATAAGGAGGG - Intronic
1028656999 7:93220033-93220055 TTTGAGAAACAGCAAGAGGCAGG + Intronic
1028720691 7:94027524-94027546 TTTGAGAAAAAAGATAAGGATGG - Intergenic
1029412707 7:100426098-100426120 TTTGAGGAACAATATAAGGAAGG - Intronic
1030184762 7:106750739-106750761 TTGCAGAAGCAGCAGAAGGAGGG - Intergenic
1032560512 7:132886829-132886851 TTGGTGAAATAGCACAAGGATGG - Intronic
1033401247 7:141027213-141027235 GTAGAGAAAAACCATCAGGAGGG + Intergenic
1034123305 7:148646858-148646880 TTATAGCAAAAGCATTAGGAAGG - Intergenic
1034659431 7:152756727-152756749 TTTGAGAAAGGGCATCAGGATGG + Intergenic
1034786344 7:153929179-153929201 TTAGAGAAACAGCCTCCTGAAGG - Intronic
1034912283 7:155006599-155006621 TTACGGCAACAGCATCAGGAAGG + Intergenic
1036556052 8:9861583-9861605 TTAGAGAAACAGTAGATGGAGGG + Intergenic
1038255155 8:25944144-25944166 TAAGAGAAAAAGCATAGGGCAGG + Intronic
1038601237 8:28945100-28945122 TTAGGGAAACCTCTTAAGGACGG - Intronic
1040671055 8:49691276-49691298 GTAGAGAAACACCATCAGGTGGG + Intergenic
1041603983 8:59758382-59758404 GTAGAGAAACCTCATAAGTATGG + Intergenic
1044113035 8:88300284-88300306 AAAGTGAAACTGCATAAGGAGGG - Intronic
1044206639 8:89498554-89498576 TAAGAGAAACAGAAAAGGGAGGG - Intergenic
1044682303 8:94794317-94794339 TTATGGAAACAAAATAAGGAGGG - Intergenic
1045214641 8:100135520-100135542 TAAGAAAAAGAGCATAAGAAAGG + Intronic
1046405378 8:113765866-113765888 ATAGAAAAACAGCAAAAGTAAGG + Intergenic
1046511447 8:115209449-115209471 TGAGAGAAACAGCTTGAAGATGG + Intergenic
1046728022 8:117695386-117695408 TTAGAGAAAGAACATTTGGAAGG + Intergenic
1046916207 8:119680790-119680812 TTAGAGAAACATCTAAAGGCCGG + Intergenic
1047057044 8:121176810-121176832 ATAGAGAAACAACCTATGGAAGG - Intergenic
1047163046 8:122403144-122403166 TTACAGAAACTGCAGGAGGAGGG + Intergenic
1047391666 8:124457036-124457058 GTAGAGAAAAAGCTTAAGGGAGG - Intronic
1049193947 8:141305404-141305426 TTAGTGAAACACCATCAGAAGGG - Intronic
1050217511 9:3344000-3344022 TTAGAAAAACAGCATTTGTAAGG - Intronic
1050936928 9:11410056-11410078 TTAGAAAAAGAGAATAAAGACGG + Intergenic
1051611838 9:18968910-18968932 TTAGAGAAGCATAATAAGGTAGG + Intronic
1056342234 9:85647984-85648006 TGAGAGAGACAGCATACGGGTGG + Intronic
1056733704 9:89186304-89186326 TTAGAAATACAGAATATGGAGGG - Intergenic
1058151997 9:101473587-101473609 GTAGAGAAACTGGACAAGGAAGG + Exonic
1060743641 9:126115738-126115760 TGAGAGAAACAGCCTTAGGTGGG + Intergenic
1061042707 9:128149213-128149235 AGAAAGAAACAGCACAAGGAAGG + Exonic
1187077534 X:15950107-15950129 TGAGAGAAACATATTAAGGAAGG - Intergenic
1188204837 X:27343236-27343258 GAAGAAAAACAGCACAAGGAGGG + Intergenic
1188693714 X:33161574-33161596 TTTCAGAAACAGCAAAAGGTGGG - Intronic
1189438184 X:41011087-41011109 TTAGAAAAACAAGATAAAGAAGG - Intergenic
1189907582 X:45777375-45777397 AAAGAGAAACAGGATAAGGAAGG + Intergenic
1192725112 X:73741771-73741793 TTAGAGAACCAGCATGGTGAGGG - Intergenic
1194039565 X:88923013-88923035 GGAGAGAAACAGCATAAGTTTGG - Intergenic
1194532833 X:95072095-95072117 GTAGAGAAACATCATCAGGTGGG - Intergenic
1195057042 X:101156303-101156325 TTAAAGAAAGAGGATAAGGCGGG - Intronic
1195615067 X:106905671-106905693 TCCGAGAATCAGCAGAAGGAAGG + Intronic
1197463431 X:126771711-126771733 GTAGAGAAAGACCATCAGGAGGG - Intergenic
1198007309 X:132509005-132509027 TTAGAGCAACAGAATAATAATGG + Intergenic
1199054863 X:143281860-143281882 TCAGGGAAACAGAATAAAGAAGG + Intergenic
1199340267 X:146669380-146669402 TTATAGAAAAAGCATAGAGAGGG - Intergenic
1200686071 Y:6261103-6261125 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1200991607 Y:9352350-9352372 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1200994263 Y:9372626-9372648 TTGGAGAAACAGAAAAAGGTTGG - Intronic
1200996927 Y:9392966-9392988 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1200999442 Y:9461518-9461540 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1201002097 Y:9481824-9481846 TTGGAGAAACAGAAAAAGGTTGG - Intronic
1201004762 Y:9502110-9502132 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1201007415 Y:9522436-9522458 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1201010023 Y:9542288-9542310 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1201540173 Y:15097352-15097374 TAAAAGAAACAACATAAGGTGGG + Intergenic
1201939708 Y:19446799-19446821 CTAGAGAAATAGGAAAAGGAAGG - Intergenic