ID: 983377560

View in Genome Browser
Species Human (GRCh38)
Location 4:166949567-166949589
Sequence CTCCAACAGACGTGCAGCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8232
Summary {0: 2, 1: 104, 2: 3995, 3: 2916, 4: 1215}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983377560_983377569 26 Left 983377560 4:166949567-166949589 CCTTAGCTGCACGTCTGTTGGAG 0: 2
1: 104
2: 3995
3: 2916
4: 1215
Right 983377569 4:166949616-166949638 GTTTGCCTGGGTATCCACAGCGG 0: 8
1: 42
2: 2217
3: 1674
4: 864
983377560_983377564 13 Left 983377560 4:166949567-166949589 CCTTAGCTGCACGTCTGTTGGAG 0: 2
1: 104
2: 3995
3: 2916
4: 1215
Right 983377564 4:166949603-166949625 CACTCCAGACCCTGTTTGCCTGG 0: 2880
1: 2381
2: 1178
3: 583
4: 480
983377560_983377565 14 Left 983377560 4:166949567-166949589 CCTTAGCTGCACGTCTGTTGGAG 0: 2
1: 104
2: 3995
3: 2916
4: 1215
Right 983377565 4:166949604-166949626 ACTCCAGACCCTGTTTGCCTGGG 0: 2861
1: 2373
2: 1149
3: 536
4: 463

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983377560 Original CRISPR CTCCAACAGACGTGCAGCTA AGG (reversed) Intronic
Too many off-targets to display for this crispr