ID: 983379032

View in Genome Browser
Species Human (GRCh38)
Location 4:166967892-166967914
Sequence CAAAATGCTGATAGTGATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 519
Summary {0: 3, 1: 43, 2: 79, 3: 85, 4: 309}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983379029_983379032 4 Left 983379029 4:166967865-166967887 CCTAGAGACTTACTGAATGGTTA 0: 1
1: 6
2: 82
3: 697
4: 2509
Right 983379032 4:166967892-166967914 CAAAATGCTGATAGTGATGTGGG 0: 3
1: 43
2: 79
3: 85
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983379032 Original CRISPR CAAAATGCTGATAGTGATGT GGG Intronic
900395995 1:2453484-2453506 CGGAATGCTGACAGTGATCTGGG + Intronic
901486619 1:9567710-9567732 TAAAATGCAGATTCTGATGTAGG - Intronic
904413323 1:30338574-30338596 GATAATGGTGATAGTGATGATGG + Intergenic
906760568 1:48373410-48373432 AAAAATTCTGATAGCGATATGGG - Intronic
906955296 1:50369139-50369161 TATAATGATGATAGTGATGATGG + Intergenic
907546539 1:55264674-55264696 AAAAACTCTGATAGTTATGTAGG + Intergenic
908655988 1:66389565-66389587 CACATTTCTAATAGTGATGTAGG + Intergenic
908919180 1:69169587-69169609 CAAAATGCTGATAATGATATAGG + Intergenic
909061734 1:70886625-70886647 AAAGATGCAGAGAGTGATGTGGG - Intronic
909104434 1:71391347-71391369 CAAAATGCTGATAGTGATACAGG + Intergenic
909174910 1:72345091-72345113 CAAAATTTTGATTGTGAAGTAGG + Intergenic
909236019 1:73153345-73153367 GAAAATGCTGATAGTGATAATGG - Intergenic
909752459 1:79179593-79179615 CAAAAGCCTGATAGTGATATGGG - Intergenic
909957563 1:81799571-81799593 CAAAATACTGATAGGTATTTAGG + Intronic
911407731 1:97463659-97463681 AAAAATGCTGATAATGATAAGGG + Intronic
911445446 1:97986311-97986333 CAAAATGCTGAGGGTGGGGTGGG - Intergenic
912121607 1:106478856-106478878 CAAAATGCTGATGATGATATGGG + Intergenic
912267508 1:108173766-108173788 CAAAATGCTGATAGTAATATGGG + Intronic
913201369 1:116497443-116497465 CAAAATGCTGTTAGGTAAGTGGG - Intergenic
913665101 1:121040934-121040956 CAAGATGTTGATAGTGAGGGAGG + Intergenic
914016493 1:143824208-143824230 CAAGATGTTGATAGTGAGGGAGG + Intergenic
914161290 1:145136793-145136815 CAAGATGTTGATAGTGAGGGAGG - Intergenic
914655110 1:149732748-149732770 CAAGATGTTGATAGTGAGGGAGG + Intergenic
915369836 1:155339526-155339548 CAAAATGCTGATAATCATTGTGG - Intronic
916517212 1:165530477-165530499 CAAAATGTTAATAGTGATAATGG + Intergenic
916532219 1:165667916-165667938 AAAAATGTTGATAGTTTTGTAGG - Intronic
917652619 1:177093952-177093974 ATAAATACTGATACTGATGTTGG + Intronic
917661034 1:177177062-177177084 CAATATGTTGATAGTGTGGTGGG + Intronic
917771951 1:178289112-178289134 CACAATTCTGGCAGTGATGTGGG - Intronic
917816684 1:178717477-178717499 CACAATGAAGATAGTGGTGTAGG + Intergenic
917984489 1:180301647-180301669 CAAAATGCCACTAGTGATGCTGG - Intronic
919409787 1:197228546-197228568 CAAAATGCTGATAGTAATATTGG - Intergenic
920927780 1:210358837-210358859 CAAAATGCTGAGAGTGAAAAGGG + Intronic
921274084 1:213500292-213500314 CAAAATGAAGATGGTGATATTGG - Intergenic
921325684 1:213984707-213984729 CAGGGTGCTGATAGTGATGGTGG + Intronic
921387373 1:214584236-214584258 CAAAGTGCTGCTAGTGATACTGG + Intergenic
921996673 1:221426661-221426683 CAAAATGCTGATAATGATAATGG - Intergenic
922310700 1:224387229-224387251 AAAACTTCTGATAGTGCTGTAGG - Exonic
922846718 1:228691184-228691206 GGAAATGCTGATAGTGAGGGAGG - Intergenic
922950576 1:229555588-229555610 CAAAATGCTGAGACAGATGGAGG + Intronic
923440107 1:234009782-234009804 CAATCTGCTGATAGTCATATTGG - Intronic
924387432 1:243511946-243511968 CAAAATTCTGAAGGTTATGTGGG + Intronic
1065166188 10:22980175-22980197 AAAAATGCTGATAATAATTTAGG - Intronic
1065401167 10:25303089-25303111 GTAAATGCTGATAGTAATTTAGG + Intronic
1066273398 10:33845185-33845207 CAAAATGCTGATAATGATATGGG - Intergenic
1067783216 10:49224039-49224061 CAAAATGCTGATAATGATATGGG - Intergenic
1068156359 10:53204922-53204944 GATAATGTTGATAGTGGTGTAGG + Intergenic
1068233839 10:54206400-54206422 TAAAATTCTGATAGTGATAAAGG + Intronic
1068298289 10:55104774-55104796 CAAAGTGCTACTAGTGATGCCGG - Intronic
1068367865 10:56075574-56075596 AAAAATGATGATAATGATGATGG - Intergenic
1070009504 10:72458525-72458547 CAACATGATGATTGTGAAGTTGG + Intronic
1071007580 10:80900567-80900589 CAAAATGCCAATAGTGCTGAGGG + Intergenic
1071174087 10:82903431-82903453 CAAAGTTCTGCTAGTGATGCTGG + Intronic
1072093787 10:92156325-92156347 AAAAATGAAGATAATGATGTTGG + Intronic
1072185944 10:93039156-93039178 CAAAAGGCTGATATTGCTGAAGG + Intronic
1072296103 10:94010847-94010869 CAAAATACTGATAGAAATATGGG - Intronic
1072360270 10:94652712-94652734 TAAATTGTTGATAGTGAAGTGGG - Intergenic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1073152200 10:101319735-101319757 CAAAATGCTGATAAGCCTGTGGG + Intergenic
1073670518 10:105582553-105582575 CAAGATTCTGATAATGATATTGG + Intergenic
1074083467 10:110186716-110186738 TCAAATGCTGATAAGGATGTGGG - Intergenic
1074918154 10:117979165-117979187 CAGAATGTTGATAGTGGGGTAGG + Intergenic
1075917135 10:126177826-126177848 CAAAAGCCTGATAGTGAAGAAGG - Intronic
1077379148 11:2220400-2220422 TAAAATGCTGATAGACATGCAGG - Intergenic
1077736923 11:4801083-4801105 CAAAATGCTGATAGAAATATGGG - Intronic
1077876163 11:6308569-6308591 CAAAATGTTAATAGTGATGAGGG - Intergenic
1078393275 11:10955140-10955162 CAAAATGCTGATAGGGATATGGG + Intergenic
1078899527 11:15628603-15628625 AAAAGTGCTGATGGTGTTGTGGG + Intergenic
1079084560 11:17435999-17436021 CCAACTGTAGATAGTGATGTGGG + Intronic
1079559520 11:21804561-21804583 CAAAATCCTAACAGTGATATGGG - Intergenic
1079593585 11:22212581-22212603 CACACTGCTGATAGGGTTGTGGG - Intronic
1079707443 11:23638295-23638317 CAAATTGCTGATAGTGATATGGG - Intergenic
1079838742 11:25367547-25367569 CAAAATGGTGATAATTATATGGG - Intergenic
1079872817 11:25821779-25821801 CAAAATGCCAATAGTGATGCAGG + Intergenic
1080204986 11:29717886-29717908 CAAAATGCTGATAATAATATGGG - Intergenic
1080997171 11:37618383-37618405 CAAAATACTGATAGTAACATGGG + Intergenic
1081122757 11:39286521-39286543 CAAAATACTGATAGCGATATGGG - Intergenic
1081554809 11:44148802-44148824 GATGATGCTGATAGTGATGATGG + Intronic
1082177372 11:49076695-49076717 CAAAATGCTAATGATGATGGTGG - Intergenic
1082733212 11:56825391-56825413 CAAAATGCTGATAGTAATATGGG - Intergenic
1083010521 11:59393531-59393553 CAAAGTGCTACTAGTGATGCTGG + Intergenic
1083982449 11:66184021-66184043 CAAAATGATGGTCGTGAGGTAGG - Intronic
1086688346 11:89759143-89759165 CAAAATGCTAATGATGATGGTGG + Intergenic
1086717514 11:90080802-90080824 CAAAATGCTAATGATGATGGTGG - Intergenic
1086992082 11:93314431-93314453 TAAAATGCTGATAGTGATATGGG - Intergenic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1088069123 11:105759411-105759433 TAAAATGCTGACATTTATGTGGG + Intronic
1088622170 11:111696904-111696926 CTAAATGCATATAGTGAAGTGGG - Intronic
1088800717 11:113304836-113304858 CAAAATGTTAATAGTACTGTTGG + Intergenic
1090130324 11:124135270-124135292 CAAGATGCTGACAGGGATCTGGG + Intronic
1090153874 11:124415221-124415243 CAAAATGCTTATATTCCTGTGGG + Intergenic
1090314776 11:125776581-125776603 CAAAATGCTGATAATGTGGCAGG - Exonic
1090506603 11:127321514-127321536 TAAAATGCTGATAGTGTTATGGG - Intergenic
1090644899 11:128759499-128759521 CTAAGTGATGATAGTGATTTTGG + Intronic
1090685477 11:129113107-129113129 CAAAATGCTACTAGTGATGCTGG - Intronic
1091956905 12:4652537-4652559 CCAAATGCTGAAAGTGAAGTAGG - Intronic
1092486003 12:8902533-8902555 CAAAATGCTGATAGCGATATAGG - Intergenic
1094348998 12:29502407-29502429 CAAAATAAAGATAGAGATGTAGG + Intronic
1094421250 12:30273439-30273461 CAAAATGCTGATAGTAATATGGG - Intergenic
1094738176 12:33259101-33259123 CAAAATGCTGTTAGTGAATGTGG + Intergenic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1096662006 12:53131493-53131515 CAAAATGCTGACACAGATGGAGG + Intergenic
1096960340 12:55570708-55570730 CAAAATACTGATAGCAATATGGG - Intergenic
1097050558 12:56220922-56220944 CAAGAGACTGATAGTGTTGTTGG - Intronic
1097317301 12:58185597-58185619 CAAAATCCTGATGGAGAGGTTGG - Intergenic
1097343751 12:58468239-58468261 AAAAATGGTGATAGTGATATGGG - Intergenic
1098078667 12:66760147-66760169 AAAAATGCTGATAGTGTGCTGGG - Intronic
1098115481 12:67171972-67171994 CAAGATGCTCATATTGATGAGGG - Intergenic
1098741663 12:74179832-74179854 CAAAATGCTTACAGTGATACGGG - Intergenic
1099307676 12:80978164-80978186 AAAAATGCTGATTCTGATGGGGG + Intronic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099495611 12:83342710-83342732 CAAAATGCTGATAGTGGTATGGG + Intergenic
1099607848 12:84828251-84828273 CAAAATGCTAATACTGATATGGG + Intergenic
1099655168 12:85479921-85479943 CAAAATGCTGGTAGTGATATGGG - Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1099683473 12:85857272-85857294 CAAAATTCTGAGATTGATGGTGG - Intergenic
1100579109 12:95921889-95921911 CAAAATGATTCTAGTGATTTGGG - Intronic
1101190359 12:102326181-102326203 TAAAATGCTGATAGTGATATGGG + Intergenic
1101472091 12:105007450-105007472 TAAAGTGCTACTAGTGATGTTGG - Intronic
1101526465 12:105535651-105535673 CAAAATGCTGATAGGGATATGGG - Intergenic
1101872675 12:108578819-108578841 CACAATGATGATGGTGATGGTGG - Intergenic
1102411465 12:112723563-112723585 CAAAATGCCATTAGTGATGTTGG - Intronic
1102417593 12:112777917-112777939 CAAAATGCTTTTTGTCATGTAGG + Intronic
1104142609 12:126003367-126003389 CAAAATGCTGATAGTGATGTAGG + Intergenic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1105634027 13:22200014-22200036 AAAAATGGTGATGGTGATGATGG + Intergenic
1105734519 13:23254236-23254258 CAAAATGCTGTTAGAAATGTGGG + Intronic
1107234338 13:38150902-38150924 CCAAATGCTGGTAAAGATGTGGG + Intergenic
1107806688 13:44159936-44159958 TAAAATGCAGATGATGATGTTGG - Intronic
1109308098 13:60662587-60662609 CCCAATGCTGATAGTGAGGAAGG - Intergenic
1109359703 13:61280214-61280236 CAAAATGCTAATAGTGATATTGG + Intergenic
1109594887 13:64538373-64538395 CAAAATGCTGATATTAAAGGTGG - Intergenic
1110007662 13:70293249-70293271 CAAAATGTTGATGGTGATATGGG + Intergenic
1110563291 13:76932249-76932271 CAAAATGCCATTAGTGATGCTGG - Intergenic
1111172490 13:84545896-84545918 CCAAATGCTGATTGTCCTGTAGG + Intergenic
1111221242 13:85207840-85207862 CAAAGTGCTGATAGTGATATGGG + Intergenic
1111580551 13:90217454-90217476 GAAAATGATGATAGGGATGACGG + Intergenic
1112859015 13:103807793-103807815 CAAAATGCTGGTAGTTACATGGG + Intergenic
1112861455 13:103833063-103833085 CAAAATACTGATACTGATATTGG + Intergenic
1114058320 14:18995623-18995645 TAAAATGCTGACATTCATGTAGG - Intronic
1114104226 14:19406131-19406153 TAAAATGCTGACATTCATGTAGG + Intronic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1114797321 14:25731153-25731175 CAAATTGCTGATGATAATGTTGG - Intergenic
1114917271 14:27284740-27284762 CAAAATGCTGATAAAGATTTTGG + Intergenic
1114961278 14:27893089-27893111 CAAAATGTTGATAATCATATGGG + Intergenic
1115932719 14:38515256-38515278 CAAAAAGCTTATGGTAATGTAGG - Intergenic
1116147848 14:41098975-41098997 CAAAATGCTGATAGCAATATGGG + Intergenic
1116627067 14:47278794-47278816 CAAAAAGCTAATAATAATGTAGG - Intronic
1116784036 14:49268240-49268262 CAAAATGCTGATAGTGATTTGGG + Intergenic
1117402225 14:55368831-55368853 CAAAATGCTCATAGTGTGGATGG + Exonic
1118986431 14:70759595-70759617 CAGAAGCCTGAAAGTGATGTGGG - Intronic
1120072723 14:80122036-80122058 CAAAATGCTGATAGAAATATGGG + Intergenic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1123827176 15:24093734-24093756 CACAATGCTGATAGTGACATGGG - Intergenic
1123841782 15:24254613-24254635 CACAATGCTGATAGTGACATGGG - Intergenic
1123861159 15:24468067-24468089 CACAATGCTGATAGTGACATGGG - Intergenic
1125022479 15:34998920-34998942 CTATATTCTGATAGTGATGGTGG + Intergenic
1126512954 15:49501292-49501314 CAAAATGCTGATACTGATATGGG + Intronic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1127643800 15:60940094-60940116 AAAAATGCTGATAGGGTTGGAGG - Intronic
1127876011 15:63112018-63112040 CAAAATGGAGATAGTGATGCAGG - Intergenic
1130350686 15:83089055-83089077 CAAAATCCTGGTAGTGAAGCGGG + Intergenic
1130762233 15:86832664-86832686 CAAAATGCTGACAGTGATATGGG - Intronic
1131410101 15:92200401-92200423 CAAAATGCTGATAGAAATATGGG + Intergenic
1131453657 15:92566408-92566430 CAAAATGCTCATAGAAATATGGG - Intergenic
1135744850 16:25008149-25008171 CAAAATGGTGATAGGGATTGTGG - Intronic
1136662808 16:31780059-31780081 CAAAATGCTGGTAGTGATATGGG + Intronic
1137462619 16:48679371-48679393 CAAATTGATGATACTGAGGTGGG + Intergenic
1137752859 16:50879782-50879804 GAAGATGCTGATATTCATGTTGG + Intergenic
1137888142 16:52128526-52128548 TAAAATGCAAATAGAGATGTGGG + Intergenic
1138805832 16:60087180-60087202 CAAAAATCTGAAAGTGATTTTGG - Intergenic
1139041240 16:63001518-63001540 CAAAATGCTGATAGTAATGTGGG + Intergenic
1139083983 16:63561904-63561926 CAAAATGCTGATAATGATATGGG - Intergenic
1140189977 16:72807145-72807167 CAAATTGGTGAAAGAGATGTAGG - Intronic
1140468063 16:75197912-75197934 CAAAATGCGGATGCTGAGGTGGG - Intergenic
1140568726 16:76076293-76076315 CAAGATGTTGATAGTGAAGGAGG - Intergenic
1141823621 16:86464171-86464193 GAAAATGGTGATAGTGATGGTGG + Intergenic
1142909981 17:3080656-3080678 CAAAATGTTGAAAGTGATAATGG - Intergenic
1142976027 17:3645016-3645038 CAGGATGCTGAAAGTGATGCTGG - Intronic
1146640906 17:34540684-34540706 CAAAATGGTGATAGGGAAGCTGG - Intergenic
1147839782 17:43363049-43363071 CAGAATACGGATACTGATGTGGG + Intergenic
1148518178 17:48242054-48242076 GAAAATGCTTCTAGTGTTGTTGG - Intronic
1149025004 17:52017343-52017365 CAAAATGCTGATAGAAACATTGG + Intronic
1153144219 18:2011233-2011255 TAAATTGCTGAAAGTGAAGTAGG - Intergenic
1153360956 18:4196389-4196411 AAAAATGCTGATTGCCATGTGGG + Intronic
1153777832 18:8469265-8469287 CAGAATGCAGAAAGTGGTGTTGG - Intergenic
1154045123 18:10897081-10897103 CACACTGCTAATAGTGTTGTGGG + Intronic
1154236736 18:12612931-12612953 CATAATGGTGGTAGTGATGGTGG - Intronic
1154391659 18:13941828-13941850 CATAATGCCAATTGTGATGTAGG + Intergenic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1156249682 18:35340566-35340588 AAAAATTCTGAGAGTGAAGTTGG - Exonic
1156641537 18:39106917-39106939 CCAAAGGCTGATATTGATGGTGG + Intergenic
1157712652 18:49860416-49860438 TAAAATGGTGATAATGATGCTGG + Intronic
1158754219 18:60302709-60302731 TATAATGCTGATAGTGTTGATGG + Intergenic
1158911244 18:62065049-62065071 CCAAAGGCTGATACTGATGCAGG + Intronic
1160143180 18:76344242-76344264 AATAATGGTGATAGTGATGATGG + Intergenic
1166017420 19:39993266-39993288 TAAAATGCTGATAGTGATAACGG + Intronic
1166018173 19:39999537-39999559 CAAAGTGTTAATAGTGATGCTGG - Intronic
1166088151 19:40490413-40490435 CAAAATGATTATCGTGATGGTGG - Intronic
1166718914 19:44986501-44986523 CACGATGTTGATGGTGATGTTGG - Exonic
1168702307 19:58448257-58448279 CAAAATGCTGATAATGATATGGG + Intergenic
925570949 2:5312238-5312260 TAAAATGGGGAAAGTGATGTTGG + Intergenic
925638535 2:5965658-5965680 CAAAATGCCGATAGTGATATGGG - Intergenic
926112246 2:10190856-10190878 TACAATGCTGAGAGTGATGATGG + Intronic
926375249 2:12220784-12220806 TAAAGTGTTGGTAGTGATGTGGG - Intergenic
926776772 2:16430899-16430921 CAAAAAGTTGCCAGTGATGTGGG - Intergenic
927010715 2:18900842-18900864 CAGACTGCTGGTGGTGATGTTGG + Intergenic
927835248 2:26392048-26392070 CTAAATGCTGATTGTGGTTTAGG + Exonic
929081501 2:38126948-38126970 CAAAATGCTCATAGTGATATGGG + Intergenic
929612688 2:43283485-43283507 CAAAATGCTGACAGTGATATGGG + Intronic
929900231 2:45994220-45994242 CAGAATGCTGATGGTGAGGGAGG - Intronic
930266529 2:49206533-49206555 CAAAGTGCAACTAGTGATGTTGG + Intergenic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
930952243 2:57156868-57156890 AAAAATGCTGATAGAGATATGGG - Intergenic
931045656 2:58349754-58349776 CAAAATGTTGATAATGTTGGGGG - Intergenic
931225890 2:60331466-60331488 CGAAGTGCTGCTAGTGATGCTGG + Intergenic
931453512 2:62388359-62388381 CAGAATGCTGAGACTGAGGTGGG - Intergenic
932259362 2:70314066-70314088 CAAAATGCTGAGATTGAGGCAGG + Intergenic
933046104 2:77539308-77539330 CAAAATGCTGATTGTGATATGGG + Intronic
933121027 2:78538526-78538548 CCAAATGCTGATGAAGATGTAGG + Intergenic
934999323 2:98997195-98997217 CAATATGACTATAGTGATGTAGG - Intergenic
935223560 2:101035079-101035101 AAAGAGGCTGATAGTGAAGTAGG + Intronic
935330051 2:101970342-101970364 CAAAATGCAGATAGAAATATGGG - Intergenic
935913764 2:107926425-107926447 CAAAATGCTGAAAGTGGCGCTGG - Intergenic
936105563 2:109621578-109621600 GAAATTTCTGATATTGATGTTGG + Intergenic
936850889 2:116896334-116896356 AAAAATGCTGATAGTGATATAGG - Intergenic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
938186492 2:129236775-129236797 CAAAATGTTGATAGGAATCTGGG + Intergenic
938476738 2:131622565-131622587 TAAAATGCTGACATTCATGTAGG - Intergenic
939482770 2:142770371-142770393 CAAAATGCTGATAGTGACATGGG + Intergenic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
940594309 2:155770127-155770149 CAAAATGATGGTGATGATGTTGG - Intergenic
940621644 2:156120989-156121011 CAAAATGCTAATAGTGATATGGG + Intergenic
940734589 2:157435925-157435947 CAAAATTCCTACAGTGATGTAGG - Intronic
941232044 2:162922529-162922551 CAAAATCATGATAGAGATGATGG + Intergenic
941578647 2:167267894-167267916 CAAAATGCTGATAATGATATGGG + Intergenic
941650911 2:168091755-168091777 CAAAATGTTGATAATGTTGAAGG - Intronic
942265122 2:174216348-174216370 CAAAGTGCTATTAGTGATGCTGG + Intronic
942967577 2:181915558-181915580 GCAAGTGCTGAAAGTGATGTGGG + Exonic
943223583 2:185140695-185140717 CAAAAAGCCGATAGTGATGTGGG - Intergenic
943808085 2:192148967-192148989 AAAAATGCTGAAAATGCTGTGGG - Intronic
944102885 2:196047433-196047455 CAAGTTGATGATAGTTATGTTGG - Exonic
944452948 2:199861599-199861621 CATGATGATGACAGTGATGTAGG - Intergenic
944571444 2:201049213-201049235 CAATTTGCTGAGAGAGATGTGGG - Intronic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
946610286 2:221450431-221450453 CAAGACTCTGCTAGTGATGTTGG - Intronic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
948158348 2:235802621-235802643 CAAAATGATGGTGGTGATGATGG + Intronic
1170725164 20:18919682-18919704 CACAATGCTGATAGTGATATGGG + Intergenic
1171217840 20:23365128-23365150 AAAACTGCTGAGGGTGATGTGGG + Exonic
1171260195 20:23725204-23725226 AAAAGTGCTGATGGTGATGGTGG - Intergenic
1171280414 20:23891433-23891455 GAAAATGGTGATGGTGATGATGG - Intergenic
1173323519 20:42010746-42010768 CAAAATGCTGACAGTGATAATGG - Intergenic
1175060239 20:56235376-56235398 CAATATTCTGATAGAGACGTTGG - Intergenic
1175933496 20:62504436-62504458 GAAAATGGTGATGGTGATGATGG - Intergenic
1176657789 21:9603282-9603304 CAAAATGCTGATAATGATATGGG - Intergenic
1177348897 21:19909756-19909778 CCAAATGTTTATACTGATGTAGG + Intergenic
1177394180 21:20511550-20511572 TAAAATGCTGATAGTGATATGGG - Intergenic
1177604557 21:23360804-23360826 CAAAACGCTGATAGTGATACGGG - Intergenic
1177614664 21:23501168-23501190 CAAAATGCTGGTAGTGATATGGG + Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1177992730 21:28058182-28058204 CTAAATGCTGACAATGATATGGG + Intergenic
1178143882 21:29716492-29716514 CAAAATGCTGATAGTAATGTGGG + Intronic
1178149665 21:29779842-29779864 CAAAATGTAGATAGTGAGATTGG + Intronic
1179156464 21:38855975-38855997 CAAAATGCTGATAATAATAGGGG + Intergenic
1179280977 21:39934023-39934045 CAAGATGATGATATTGAAGTGGG - Intergenic
1179306333 21:40156710-40156732 CACAATGGTGGTAGTGATATAGG + Intronic
1179566006 21:42249632-42249654 CAAAATGATGATGCTGATGATGG - Intronic
1180476808 22:15718242-15718264 TAAAATGCTGACATTCATGTAGG - Intronic
1180685776 22:17665327-17665349 CAAAATGCTGACAGTGATATGGG - Intronic
1181879769 22:25968894-25968916 CAAATGGCTGATAGTCATGGTGG + Intronic
1182376378 22:29851479-29851501 CAAGAGGCTAAAAGTGATGTGGG + Intergenic
1182458284 22:30466709-30466731 CAAAATGGGGATAGCAATGTAGG - Intronic
1184317211 22:43704156-43704178 AAATCTGCTGATAGTCATGTTGG - Intronic
949959454 3:9300198-9300220 CAAGTTGATGATAGTGTTGTTGG - Intronic
950256347 3:11509904-11509926 CAGGATCCTGATAGTGATCTTGG + Intronic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
955754551 3:62214654-62214676 CAAGATGATGATAGTGGTGGTGG + Intronic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
958493466 3:94809926-94809948 CAAAATCCTGATTCTTATGTAGG + Intergenic
958583342 3:96053796-96053818 AAAAATGTGGATAGTGATGTGGG - Intergenic
959225365 3:103575304-103575326 AAAAATGGTGATAGTCATTTAGG + Intergenic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
959525982 3:107377750-107377772 CAAGATGATGATAGTTATGACGG + Exonic
960024033 3:112988214-112988236 CAACATGGTGATAGGGAAGTGGG - Intergenic
961937061 3:130595980-130596002 CCAAGTGCTGATAAGGATGTGGG + Intronic
962139564 3:132774272-132774294 CAATATCTTGATAGTGATATGGG - Intergenic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
963433805 3:145242550-145242572 CAACATGCTGATAGTGATAAGGG - Intergenic
963539566 3:146567790-146567812 CAAAATGATGATAGTGATATGGG - Intergenic
964076786 3:152701462-152701484 CAGAATGCTCATAGTGATAGTGG - Intergenic
964520830 3:157564453-157564475 CAAAATGCTGATAGTGATACGGG - Intronic
964730666 3:159861184-159861206 CACAATGCTGCTAGTAAGGTGGG + Intronic
965232713 3:166073438-166073460 AAAAATGCTGATAGAAATATGGG - Intergenic
965326460 3:167310228-167310250 CAAAATGCTTATAGTGATAATGG - Intronic
965349305 3:167594280-167594302 CAAAATGTTCATAGTGATATGGG + Intronic
965357940 3:167700371-167700393 CAAAGTGCCACTAGTGATGTTGG + Intronic
965541379 3:169875010-169875032 GAAAATGTTGATGGTGAAGTGGG + Intergenic
966075783 3:175935602-175935624 CAAAATGCAGGTAGTGATATGGG + Intergenic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
969142752 4:5093866-5093888 CAAAGTGCTAAGAGTGATGCTGG + Intronic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
969545164 4:7821333-7821355 CAAAATGCTGACAGTAATGACGG - Intronic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
970968466 4:21954107-21954129 TAAAATGATGATAGTGATTAAGG - Intergenic
971546205 4:27890522-27890544 CAAAATGTTGATAGTGATATGGG + Intergenic
971972478 4:33637752-33637774 CAAAATGCTGATAGAGAATAAGG - Intergenic
972896022 4:43620928-43620950 CAAAATGCTGATAGTAATATGGG - Intergenic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
974637921 4:64589675-64589697 CAGAATGCTGATAGTGATATGGG + Intergenic
974724105 4:65777061-65777083 CAAAATTCTGATAATGATACGGG + Intergenic
975819658 4:78257024-78257046 CAAAATGGTGGTAGTGATGGTGG - Intronic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
978082400 4:104610000-104610022 CCAGAGGCTGATAGTGATGGGGG - Intergenic
979060987 4:116059935-116059957 CAAAGTGCTGATAGTGATGTGGG - Intergenic
979125708 4:116969397-116969419 CAAAATGCTAATAGTGCTATTGG - Intergenic
979362811 4:119784286-119784308 CCAAATATTGATAGTGATGTGGG - Intergenic
979423857 4:120540163-120540185 CAAAATGCTTATAGTCATGTTGG - Intergenic
979942173 4:126775335-126775357 CAAAACACTGAAAGTGATATTGG - Intergenic
980731818 4:136833585-136833607 CAAAAGCCTGGTAGTGATATGGG + Intergenic
981016236 4:139977331-139977353 TAAAATGCTGATAGTGCCGAGGG + Intronic
981343249 4:143647051-143647073 TAAAATGTTGATAGTGATATGGG + Intronic
981355372 4:143783941-143783963 CAAAATGCTGGTAGAAATATGGG + Intergenic
981391464 4:144196361-144196383 CAAAATGCTGATAGTGATACAGG + Intergenic
981412066 4:144443373-144443395 CAAAATGCTGTTAGTAATACGGG - Intergenic
981503193 4:145474189-145474211 CAAAATGCTAATAGTGATATGGG - Intergenic
981842887 4:149132918-149132940 TAAAATGCTGATAGTGATATGGG + Intergenic
982137134 4:152282431-152282453 CACAATGCTGATCGTTGTGTAGG - Intergenic
982210281 4:153029194-153029216 CAAAATGCTGATAGAAATATGGG - Intergenic
983320427 4:166190070-166190092 GAAAATGCTGATAATGATATGGG + Intergenic
983379032 4:166967892-166967914 CAAAATGCTGATAGTGATGTGGG + Intronic
983660360 4:170125563-170125585 TAAAATGCTGATAATGATATTGG + Intergenic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
983818877 4:172168542-172168564 CAAGATGGTGATGGTGATGATGG + Intronic
984131358 4:175879139-175879161 CAAAATGCTAATAATGATATGGG - Intronic
984512358 4:180694017-180694039 CAAAATACTAATAGTGATATAGG - Intergenic
985417621 4:189752804-189752826 CAAAATGCTGATAATGATATGGG + Intergenic
986430945 5:7680345-7680367 CAAAATGCTGATAGCGCTGAGGG + Intronic
986537426 5:8805375-8805397 CAAAATGCTGATAGTAATATGGG + Intergenic
986911693 5:12565592-12565614 CAAAATGTCGATAATGATATTGG - Intergenic
987459955 5:18197400-18197422 CAAAATGCTGAAAGAAATATGGG + Intergenic
987533209 5:19148797-19148819 CAAAATGCTGATAGTGACGAGGG - Intergenic
987542424 5:19273103-19273125 CAATATTTTGTTAGTGATGTTGG - Intergenic
987918647 5:24249435-24249457 CAAAATGCTGACAGTGACATGGG - Intergenic
988009510 5:25464379-25464401 CATAATGCTGATAGTAATATGGG + Intergenic
988038849 5:25861985-25862007 CAAAATGCTGATAGTAATATGGG - Intergenic
988076760 5:26363821-26363843 CAATATGCTGATAGTGATAAGGG + Intergenic
988456307 5:31390007-31390029 CAAAATGCTAATAGTGATATGGG - Intergenic
988876866 5:35456644-35456666 CAAAATGCTGATGGTGATAGGGG + Intergenic
989501963 5:42178059-42178081 TGAAATGCTAATAGTGATATGGG - Intergenic
989677025 5:43984164-43984186 CAAAATGCTGACAGTGACATGGG - Intergenic
989817323 5:45751751-45751773 CAAAATGCTGATAGTGATAATGG - Intergenic
990075844 5:51844583-51844605 CAAAATGCCAATAGGGATATAGG - Intergenic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
991074707 5:62522178-62522200 CAAAATGCTGATCTTGAAGTTGG - Intronic
991186487 5:63814842-63814864 CAAAATGCTGATAGTGACATGGG + Intergenic
992994132 5:82315913-82315935 TAAAATGCTCATTGTGATGAAGG - Intronic
993001036 5:82380593-82380615 CAAAATGCTGATAATGATATGGG - Intronic
993269542 5:85776473-85776495 AAAAATGGTGATAATAATGTTGG + Intergenic
993792625 5:92225203-92225225 CAAAATACTGATAGTGAGATGGG - Intergenic
993913822 5:93717282-93717304 GAAAATGCTGAGAATGAGGTAGG + Intronic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
994849569 5:105036671-105036693 CAAAACCCTGATAGTGATATGGG - Intergenic
995211964 5:109550959-109550981 CAAAATGCTGATAGCCATATGGG + Intergenic
995779893 5:115763660-115763682 CAAAATGGTTTTAGTGATATGGG - Intergenic
996502345 5:124230761-124230783 CCAAATGCTGGTAGTGAAGTAGG - Intergenic
996809336 5:127497419-127497441 CCAAATGCTGACAAGGATGTGGG + Intergenic
997106503 5:131025927-131025949 CAAAGTGCTACTAGTGATGCTGG + Intergenic
997117646 5:131142691-131142713 CAGAATGTTGATAGTGGTGGAGG + Intergenic
999244935 5:150149080-150149102 CAAGGTGTTGATAGTGATGGCGG + Intronic
999364920 5:151016582-151016604 CAAAATGGGGATAATAATGTTGG + Intergenic
999715576 5:154357376-154357398 CAAAATGTTAATAGTGGTCTGGG + Intronic
1000033528 5:157424067-157424089 CAAAATGCCACTAGTGATGCTGG + Intronic
1000512570 5:162201749-162201771 CAAAATGCCACTAGTGATGATGG - Intergenic
1000609540 5:163359281-163359303 CAAAATGCTGATAGTGATAATGG + Intergenic
1000768416 5:165319765-165319787 CAAAAAGCTGATAGTGATATGGG - Intergenic
1000788141 5:165571317-165571339 GAAAATGTTGATAATGATGTGGG - Intergenic
1002219484 5:177668666-177668688 CAAAGTGCTACTAGTGATGCTGG + Intergenic
1003798236 6:9630197-9630219 CCAAATGCTGATAGTGACATGGG + Intronic
1004324043 6:14657468-14657490 CACAATGCTGATAGGGCTATTGG - Intergenic
1005199540 6:23327573-23327595 CAAGATGGTGATAGTGATGGTGG - Intergenic
1006344060 6:33465786-33465808 CAAAATGCTGATAGCAATATGGG + Intergenic
1006508931 6:34511312-34511334 GAAAATGCAGATTCTGATGTGGG + Intronic
1007529166 6:42525687-42525709 CAAAATGTTAATATTGTTGTTGG - Intergenic
1008284012 6:49627405-49627427 CAAAATGGTGATAGTGAGATGGG - Intronic
1008445664 6:51587080-51587102 CAAAATGTTGATAGTGAATATGG - Intergenic
1009627055 6:66147295-66147317 CAAAATGGAGATAGTCATGCGGG - Intergenic
1009635004 6:66253751-66253773 CCAAATGCTGATAATGATATGGG - Intergenic
1009710119 6:67307579-67307601 CACAACGCTGATAGTGATAATGG + Intergenic
1009732082 6:67621728-67621750 AAAAATACTGATAATGATATGGG + Intergenic
1010163813 6:72891834-72891856 CAAAAATCTGATAGTAATCTAGG + Intronic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1011489765 6:87878985-87879007 CAAAATTTTGATAGTGATGGTGG - Intergenic
1012015580 6:93845592-93845614 CAAAATGCTTATAGTCCAGTAGG + Intergenic
1012015689 6:93847182-93847204 CAAAATGCTGATAGAAATTAAGG + Intergenic
1012120993 6:95366685-95366707 CAAAATACTGATAGTGATATGGG - Intergenic
1012184650 6:96197726-96197748 CAACATCCTGCTAATGATGTTGG + Intronic
1012569001 6:100699691-100699713 CAAAATGCTGATAATGATTTGGG + Intronic
1012765499 6:103362467-103362489 CAAAATGCTCATAGTGATATGGG + Intergenic
1013332418 6:109117903-109117925 CCAAATGCTGAAAGTGCTGAGGG - Intronic
1013443096 6:110191280-110191302 CATGAAGCTGATATTGATGTTGG - Intronic
1013857883 6:114596444-114596466 CAAAATGCAAATAGTGGTGCAGG + Intergenic
1013890608 6:115021850-115021872 CAAAATGCTGATAATGATATGGG - Intergenic
1015239511 6:131007621-131007643 CAAAATGCTGATAGTAATATGGG + Intronic
1017502614 6:155039440-155039462 CAAAATGCTGATGGCCATGGTGG + Intronic
1017561724 6:155635467-155635489 CAAATTGCTGATATTGTGGTGGG + Intergenic
1018426204 6:163684727-163684749 GAAATTACTGAAAGTGATGTTGG + Intergenic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1019765896 7:2849957-2849979 GACAATGGTGATAGTGATGGTGG - Intergenic
1019765910 7:2850094-2850116 GATGATGCTGATAGTGATGGTGG - Intergenic
1019765933 7:2850262-2850284 GATGATGCTGATAGTGATGGTGG - Intergenic
1019804184 7:3110795-3110817 CCAAATGCTGACAAAGATGTGGG + Intergenic
1019964337 7:4486367-4486389 CAAAGTGCTGAGAGTGGTGGGGG - Intergenic
1020370486 7:7426990-7427012 CAATATGTTTATGGTGATGTGGG + Intronic
1020914439 7:14174763-14174785 GATAATGGTGATAGTGATGGTGG - Intronic
1020933269 7:14427337-14427359 CAAACTGCTGATAGTGATATGGG - Intronic
1022021758 7:26406345-26406367 CAAAATCCTGACAGTAATTTGGG - Intergenic
1022461019 7:30607029-30607051 CATATTGCTGATGGTGGTGTTGG - Intronic
1022947858 7:35305209-35305231 CAAACTGCTTATAATAATGTGGG + Intergenic
1024223334 7:47304762-47304784 CAGAATGCTGAGAGGCATGTGGG - Intronic
1024383614 7:48726149-48726171 CAATATGCTGATAATGATATGGG - Intergenic
1024982168 7:55166725-55166747 CACAATGGTGGTAGTGATGATGG + Intronic
1024982194 7:55166860-55166882 CACAATGGTGGTAGTGATGATGG + Intronic
1027378453 7:77577925-77577947 CAAAATGTTGATAATGAAGCTGG + Intronic
1027443283 7:78243304-78243326 CAAAATGTTAATAGCAATGTGGG + Intronic
1028228806 7:88281357-88281379 CAAAATGCAGATGGTAATGAAGG - Intronic
1028906220 7:96156914-96156936 CAAAATAATTATACTGATGTAGG + Intronic
1029200055 7:98833413-98833435 AATAATGATGATAATGATGTTGG - Intergenic
1029997673 7:105024058-105024080 CAAAATGTTGGTAGTGAATTTGG + Intronic
1031261928 7:119532438-119532460 CAAAATTCTGATAGTGATGTGGG + Intergenic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1033475986 7:141693348-141693370 CCAAATGCTGATGAGGATGTGGG + Intronic
1033562429 7:142545177-142545199 CAAAATGATGATGGAGATGTAGG - Intergenic
1034510823 7:151533198-151533220 CAAAATGCTGATAATGATATGGG - Intergenic
1036893878 8:12615122-12615144 CAAAATGCTGATGGTTATATGGG - Intergenic
1036953744 8:13165537-13165559 CACAATGCTGTTAGTGCTGAAGG + Intronic
1038382510 8:27109825-27109847 TAAAATGCTGATGGGGATGAGGG - Intergenic
1038812004 8:30856885-30856907 CAAAATTCTGATAGATTTGTTGG + Intronic
1038880541 8:31606076-31606098 CAAAATGCTGATAGTAATAAGGG - Intergenic
1039017247 8:33164808-33164830 CAAAGTGGTGATGGTGATGATGG + Intergenic
1039652306 8:39354791-39354813 CAAAATGCTGATGAGGCTGTGGG + Intergenic
1040540120 8:48346346-48346368 CAAAATGCTGATGGTGATAGGGG + Intergenic
1040774004 8:51016695-51016717 AAAAATGCTAATAATCATGTGGG + Intergenic
1041149407 8:54915709-54915731 CACAATGCTGACAGTTATTTTGG - Intergenic
1042558032 8:70050374-70050396 AAAAATACTGATACTGCTGTAGG - Intergenic
1043378365 8:79675023-79675045 CAAAATGCTGAGTGTGGTGGTGG - Intergenic
1043694665 8:83203887-83203909 CAAAATGCTGATGGTGATATGGG + Intergenic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1044105969 8:88207523-88207545 CAAAGTGCTGCTAGTGATGCTGG + Intronic
1044127104 8:88472209-88472231 CAAAATGCTGAGAGTGATATGGG - Intergenic
1044252393 8:90019248-90019270 TAAAATATTGATACTGATGTAGG + Intronic
1044326821 8:90868437-90868459 CAAAATGTCCATAGTGATATGGG + Intronic
1044906277 8:97007152-97007174 CAGAATGCTGTTAAAGATGTCGG - Intronic
1045050589 8:98320677-98320699 CAAAATGCTGATAGCAATACGGG - Intergenic
1045120748 8:99031656-99031678 GAAAATGCTGATATTGATGACGG - Intronic
1045518607 8:102883400-102883422 AATAATGCTGGTAGTAATGTAGG - Intronic
1045849198 8:106673177-106673199 CAAAATGCTGATAGTGATAATGG + Intronic
1046087159 8:109452274-109452296 CAAACTGGTAATAGTGCTGTTGG + Exonic
1046134129 8:110004471-110004493 CAAAATGCTGATAGTGATGTGGG - Intergenic
1046151855 8:110237727-110237749 CTAAATGCTGGTAAGGATGTGGG - Intergenic
1046668917 8:117036246-117036268 CAAAATGCTGACAGTGATATGGG - Intronic
1048699932 8:137077441-137077463 CAAAATGTTGATAATGATATGGG + Intergenic
1048726231 8:137388068-137388090 CACAATGCTGATAGTGATATGGG - Intergenic
1048806452 8:138245905-138245927 CAAATTGCTGATAGTGATATGGG + Intronic
1050660210 9:7876197-7876219 CAAAATGCTTATAGTAATATGGG + Intronic
1050890625 9:10819845-10819867 AAAAATGCTGAGAGTGATATGGG - Intergenic
1050897368 9:10900201-10900223 CAAAATGATGATAGTGATATGGG - Intergenic
1051569089 9:18535343-18535365 CAAAATGCTGATAGTGATACAGG - Intronic
1051718327 9:20008838-20008860 GAACATGCAGAGAGTGATGTTGG + Intergenic
1052220715 9:26018288-26018310 TAAAATGCTGATAATGATATGGG - Intergenic
1052511011 9:29420641-29420663 CAAATTGCTGACAGAGATGAGGG - Intergenic
1052635430 9:31097742-31097764 CCAAATGCTGACAATGATATAGG + Intergenic
1055174510 9:73300395-73300417 CAAAATGCTGATAATGATACGGG - Intergenic
1056076602 9:83047964-83047986 CCAAATGTTGACAGTGATGCTGG - Intronic
1057285435 9:93749742-93749764 CAAACTGCTGATAGTGATATGGG - Intergenic
1058722156 9:107773933-107773955 CAAAATGCTGACAGTTATATGGG - Intergenic
1059109015 9:111537054-111537076 CAAAGTGCTGCTAGTAATGCTGG - Intronic
1059570175 9:115425833-115425855 CTAACTGCTGATAATGATATGGG - Intergenic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1059582435 9:115566408-115566430 CAAAATGCTGATAATGATACAGG + Intergenic
1059917171 9:119116958-119116980 CAAAATGTTGATAGAAATATGGG + Intergenic
1060033570 9:120235864-120235886 CAACATGATGATAATGATGGTGG - Intergenic
1060721927 9:125985195-125985217 GATAATGATGATAGTGATGGTGG - Intergenic
1061938184 9:133870221-133870243 GAAACTTCTGATATTGATGTTGG - Intronic
1203635517 Un_KI270750v1:106856-106878 CAAAATGCTGATAATGATATGGG - Intergenic
1186076371 X:5883855-5883877 CAAAATTATGCTATTGATGTAGG - Intronic
1186823924 X:13318721-13318743 CAAAATGACGAGAGAGATGTGGG - Exonic
1187000667 X:15173547-15173569 CAAAATGCAGTGAGTAATGTGGG + Intergenic
1188053064 X:25510192-25510214 CAAAATGCTGATAATGATAATGG - Intergenic
1188749163 X:33884559-33884581 CAAAATGCTGATGGTTATATGGG + Intergenic
1189071390 X:37867288-37867310 CAGAATGCTGATAGTGATATGGG - Intronic
1189637292 X:43024275-43024297 CAAAATGCTGATAATGATATGGG - Intergenic
1189872161 X:45395227-45395249 AAATATGCTGATAGTCATATTGG + Intergenic
1190822894 X:53990886-53990908 GAAGATGGTGATAATGATGTGGG - Intronic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1191760806 X:64646452-64646474 CAAAATGTTGATAGTAATATGGG + Intergenic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1192866881 X:75143376-75143398 CAAAATGCTGATAATGATAATGG - Intronic
1192934990 X:75849954-75849976 AAAAATGCTGATAATGATATGGG - Intergenic
1193202191 X:78704626-78704648 CAAAATGGTGATGGTGTTGGTGG + Intergenic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1194064096 X:89240894-89240916 CAAAATGCTGATAGTGATAGGGG + Intergenic
1194093148 X:89602742-89602764 CAAAATGTTGATAGTGGGTTGGG + Intergenic
1194418948 X:93649034-93649056 CCAAATGGTGATGGTGATATGGG + Intergenic
1196028954 X:111074781-111074803 CAAAATGCTGATGGAGATGTGGG + Intronic
1196150312 X:112366328-112366350 CATAATGATGATGGTGATGATGG - Intergenic
1197385343 X:125795037-125795059 CAAAATGCTGATAGTAATATGGG + Intergenic
1197392302 X:125882939-125882961 CAAAATGCAGACAGTAATATGGG + Intergenic
1198569189 X:137937314-137937336 CAAAATGCTGATAGAAATATGGG + Intergenic
1198588470 X:138149197-138149219 CAAAATGCTGATAGAAATATGGG + Intergenic
1198733507 X:139760300-139760322 GAAAATGATGATAATGATGATGG - Intronic
1199264195 X:145811122-145811144 CAAAATGCTGATGATTATTTTGG - Intergenic
1199413996 X:147558714-147558736 TAAAATGCTGATACTTATCTAGG + Intergenic
1199472433 X:148209835-148209857 CAAAATACTGATAGTTATTATGG + Intergenic
1200445779 Y:3258845-3258867 CAAAATGTTGATAGTGGGTTGGG + Intergenic
1200718271 Y:6574993-6575015 CAAAATGCTGATAGTGATAGGGG + Intergenic
1201747298 Y:17391546-17391568 CAAAATGCTGATTTTATTGTGGG + Intergenic