ID: 983380071

View in Genome Browser
Species Human (GRCh38)
Location 4:166981101-166981123
Sequence GGAACGACCTGCCTGCAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 906
Summary {0: 1, 1: 10, 2: 73, 3: 269, 4: 553}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983380071_983380075 18 Left 983380071 4:166981101-166981123 CCTTTCTGCAGGCAGGTCGTTCC 0: 1
1: 10
2: 73
3: 269
4: 553
Right 983380075 4:166981142-166981164 AGCCCAGAGGAGACCCATAGTGG No data
983380071_983380073 5 Left 983380071 4:166981101-166981123 CCTTTCTGCAGGCAGGTCGTTCC 0: 1
1: 10
2: 73
3: 269
4: 553
Right 983380073 4:166981129-166981151 GTGTCCAGCTTTCAGCCCAGAGG 0: 1
1: 1
2: 9
3: 95
4: 449
983380071_983380076 19 Left 983380071 4:166981101-166981123 CCTTTCTGCAGGCAGGTCGTTCC 0: 1
1: 10
2: 73
3: 269
4: 553
Right 983380076 4:166981143-166981165 GCCCAGAGGAGACCCATAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983380071 Original CRISPR GGAACGACCTGCCTGCAGAA AGG (reversed) Intronic
901148004 1:7081034-7081056 GGAACAAGCTGCCTGCCAAAGGG + Intronic
901691241 1:10974523-10974545 GGGAAGACCTGCCTACAGAGAGG + Intronic
901936645 1:12631310-12631332 GGAACACCCTGGCTGCAGAAAGG + Intergenic
902735028 1:18394806-18394828 TGAACGGTCTGCCTACAGAACGG - Intergenic
903337470 1:22634763-22634785 AGGATGACCTGCCTGCAGAGAGG - Intergenic
903337481 1:22634834-22634856 AGAACAACTTGCCTGCAGAAAGG - Intergenic
903810555 1:26032828-26032850 TGAACCACCTGCCTGCCGCATGG + Intronic
903963290 1:27070748-27070770 GGAAGGAGCTGCCTGCTGAGAGG - Intergenic
904365699 1:30009836-30009858 GGGAAGACCTGCCTACAGAGAGG - Intergenic
904461079 1:30680146-30680168 AGGACGACCTGCCTGCAGAGAGG + Intergenic
905001360 1:34672222-34672244 GGGACAACCTGCCAGCAGAGAGG + Intergenic
905001371 1:34672293-34672315 GAGATGACCTGCCTGCAGAGAGG + Intergenic
905546133 1:38801802-38801824 AGGACGACCTGCCTGCAGAGAGG + Intergenic
906051791 1:42880570-42880592 GGGACAACCTGCCTGCAGATAGG - Intergenic
906082372 1:43101803-43101825 AGGATGACCTGCCTGCAGAGAGG - Intergenic
906216669 1:44045108-44045130 GGAGCCACCTGCCTGGAGGAAGG + Intergenic
906448208 1:45922012-45922034 GGGAGGACCTGCCTACAGATAGG - Intronic
906448222 1:45922083-45922105 GGGACCACCTGCCTGCAGAAAGG - Intronic
907020256 1:51060011-51060033 AGGACTACCTGCCTGCAGAAAGG + Intergenic
907020267 1:51060081-51060103 GGGATGACCTGCCTGCAGGTAGG + Intergenic
907020304 1:51060286-51060308 GGGATGACCTGCCTGTGGAAAGG + Intergenic
907985369 1:59524644-59524666 GGGATGACCTGCCTGCAGAAAGG + Intronic
908259278 1:62327176-62327198 GGGATAACCTGCCTACAGAAAGG - Intergenic
909197822 1:72649157-72649179 GGGACGACCTGCCTGTGGAAAGG + Intergenic
909277290 1:73703942-73703964 GGTTCAACCTGACTGCAGAATGG + Intergenic
909599661 1:77448360-77448382 GGGACAACCTGCCTGCAGATAGG + Intronic
909907867 1:81221291-81221313 GGGACAACCCACCTGCAGAAAGG + Intergenic
910101426 1:83582524-83582546 GGGATGACCTGCCTGTGGAAAGG - Intergenic
910101436 1:83582593-83582615 GGGATGACCTGCCTGCAGATAGG - Intergenic
911025799 1:93434636-93434658 GGGACAACCTGCCTGCATATAGG - Intergenic
911935146 1:103960593-103960615 GGAACAACCTGCCTGCAGATAGG - Intergenic
912013693 1:105005240-105005262 GGCATGACCTGCCTGCGGAAAGG - Intergenic
912044516 1:105437477-105437499 AGAATGACCTGCATGCAGAAAGG + Intergenic
912881757 1:113423212-113423234 AGGACAACCTGCCTGCAGATAGG - Intronic
918820663 1:189250250-189250272 AGGACGACCTGCCTGCAGAAAGG + Intergenic
919083208 1:192891164-192891186 AGAATGACCTGCCTGCAGAGAGG - Intergenic
919165255 1:193884707-193884729 TGAATGACTTGCCTGCAGAGAGG - Intergenic
919205689 1:194420009-194420031 GGGATGACCTGTCTGCAGAAAGG - Intergenic
919205698 1:194420078-194420100 AGGACTACCTGTCTGCAGAAAGG - Intergenic
919253913 1:195096750-195096772 AGGATGAACTGCCTGCAGAAAGG + Intergenic
919302793 1:195791376-195791398 GGGACAACCTACCTGCAGAAAGG + Intergenic
919933058 1:202234185-202234207 GGAAGGGCCTGGCTGCAGGAAGG - Intronic
920548252 1:206836650-206836672 GTAACTTCATGCCTGCAGAAAGG - Exonic
920678458 1:208055068-208055090 AGAAGGAGCTCCCTGCAGAACGG + Intronic
920975982 1:210785801-210785823 GGAATGAACTGCCTGTAGGAAGG + Intronic
921625433 1:217373500-217373522 GGGACACCCTGCCTGCAGAGAGG + Intergenic
921674653 1:217964818-217964840 GGGACTACCTGCCTGTGGAAAGG - Intergenic
921675257 1:217968943-217968965 GGGACTACCTGCCTGTGGAAAGG + Intergenic
921766895 1:218983133-218983155 GGGACAACCTGCCTGTGGAAAGG - Intergenic
922041641 1:221903614-221903636 GGGACATCCTGGCTGCAGAAAGG - Intergenic
922141645 1:222893985-222894007 GGGATGACCTGCCTGCGGGAGGG - Intronic
922800403 1:228362348-228362370 GGAAGTGCCTGCCTGCAGCATGG + Intronic
923328180 1:232898831-232898853 GGGACAACCTGCCTGCAGATAGG + Intergenic
923328201 1:232898977-232898999 GGGATGAGCTGCCTGCAGATAGG + Intergenic
923786144 1:237071164-237071186 AGGAAGACCTGCCTGCGGAAGGG - Intronic
1062901872 10:1152732-1152754 GGAACGCCCTGCCTCCTGCAAGG - Intergenic
1063075506 10:2712696-2712718 GGAATGAGCTGCCTGCAGGAAGG - Intergenic
1064101961 10:12471650-12471672 TGAGCTCCCTGCCTGCAGAATGG + Intronic
1064911324 10:20405184-20405206 GTAACGAGCTGCATGCATAATGG + Intergenic
1065201418 10:23316654-23316676 GGGATGACCTGCTTGCAGAAAGG - Intronic
1065201429 10:23316724-23316746 AGGATGACCTGCCTGCAGAAAGG - Exonic
1065201436 10:23316795-23316817 GGGATGACCTGCCTGCAGAGAGG - Exonic
1065976589 10:30847391-30847413 GGGAAAACCTGCCTGCAGAGAGG + Intronic
1067258672 10:44667064-44667086 GGGACAACCTGCCTGCAAAAGGG - Intergenic
1068060569 10:52063749-52063771 GGGACGACCTGCCTACAGAGAGG - Intronic
1068226916 10:54117678-54117700 GGGACTACCTGCCTGAGGAAAGG - Intronic
1068226930 10:54117744-54117766 GAGATGACCTTCCTGCAGAAGGG - Intronic
1068287697 10:54961732-54961754 GGGATGACCTGCCTGCAGAAAGG + Intronic
1068287714 10:54961841-54961863 GGGATGACCTGTCTGCAGATAGG + Intronic
1068290947 10:55001021-55001043 GAGACGACCTGCCTGAGGAAAGG + Intronic
1068300422 10:55131648-55131670 AGCACAACCTGCCTGCAGAAAGG - Intronic
1068300432 10:55131718-55131740 GGAATGACCTGCCTGCAGAGAGG - Intronic
1068367421 10:56068671-56068693 GGAACGCCCAGGCTGCAGACTGG - Intergenic
1068443925 10:57095759-57095781 GGGATGACCTGCCTGCAGATAGG + Intergenic
1068474444 10:57507291-57507313 AGGATGACCTGCCTTCAGAAAGG + Intergenic
1068474467 10:57507453-57507475 GGGATGGCCTGCCTGCAGAAAGG + Intergenic
1068868011 10:61915507-61915529 AGCACTACCTCCCTGCAGAATGG + Intronic
1069121844 10:64577200-64577222 GGGAATACCTGCCTGCAGAAAGG + Intergenic
1069561742 10:69435629-69435651 GGGACAACCTGCCTGCAGAAAGG - Intergenic
1069732067 10:70623283-70623305 CAAATGACCTGCCTGCAGAGAGG + Intergenic
1069732080 10:70623354-70623376 GGGATGACCTGCCTACAGAGAGG + Intergenic
1070096155 10:73340101-73340123 AGGACAACCTGCCTGCAGAGAGG - Intronic
1070201146 10:74207535-74207557 AGGACGACCTGCCTGCAGAAAGG - Intronic
1070401352 10:76056127-76056149 GAGATGACCTGCCTGCAGAAAGG - Intronic
1070401362 10:76056197-76056219 GGAACAACCTGCCTGTGGAGAGG - Intronic
1070428819 10:76315910-76315932 CCAATGACCTGCCTGCAGAAAGG + Intronic
1071052967 10:81473590-81473612 AGGATGACCTGCCTGCAGAGAGG + Intergenic
1071166756 10:82816363-82816385 GGGATGACCTGCCTGCGGAAAGG - Intronic
1071819323 10:89264350-89264372 GGGACAACCTGCCTGTGGAAAGG - Intronic
1071957121 10:90771139-90771161 GGGAAGACCTGCCTGCAAAGAGG + Intronic
1072154685 10:92714305-92714327 GGGACAACCTGCCTACAGAGAGG - Intergenic
1072335521 10:94395059-94395081 GGAACGACCTGCCTGCAGAGAGG - Intergenic
1072871257 10:99123719-99123741 AGAACCACCTGCCTGTAGAAAGG - Intronic
1073890622 10:108096851-108096873 GGGAGGACTTGCCTACAGAAAGG - Intergenic
1074738895 10:116465107-116465129 GGAACTACCTGCCTTCAGATAGG - Intronic
1075125458 10:119695431-119695453 GGGATGACCTGCCTGCAAATAGG - Intergenic
1075132053 10:119748589-119748611 TGGATGACCTGCCTGCAAAAAGG - Intronic
1076549102 10:131266661-131266683 AGGATGACCTGCCTGCAGAGAGG - Intronic
1077012860 11:386606-386628 GGGACGACCTTCCTGCAGAGAGG + Intergenic
1077844671 11:6012328-6012350 GGCATGACCTATCTGCAGAAAGG - Intergenic
1077844690 11:6012503-6012525 GGGATGACCTGCCTGCAGAGAGG - Intergenic
1078042729 11:7883715-7883737 AGGACTACCTGCCTGCAGAGAGG - Intergenic
1078196035 11:9137918-9137940 GCAGCGTCCTGCCTGCAGAGGGG - Intronic
1078315121 11:10288432-10288454 GGGGTGACCTGCCTGCATAAAGG - Intronic
1078315142 11:10288612-10288634 GGGACAATCTGCCTGCAGAGAGG - Intronic
1078345502 11:10544488-10544510 CGGACAACCTGCCTGCAGAAAGG - Intergenic
1078345515 11:10544558-10544580 CTGACGACCTGCCTGCAGAAAGG - Intergenic
1078423330 11:11229934-11229956 GGCACAGTCTGCCTGCAGAAGGG + Intergenic
1079472268 11:20789815-20789837 AGCAGGACCTGCCTGCAGAGAGG - Intronic
1079503916 11:21132985-21133007 GGGATGACCTGCCTGCAGAAAGG - Intronic
1079710666 11:23679641-23679663 GGGATGACCTGCTTGCAGAGAGG - Intergenic
1079710694 11:23679806-23679828 AGGACAACCTGCCTGCAGAGAGG - Intergenic
1079882270 11:25943487-25943509 AGGACGACCTGCCTACAGAGGGG - Intergenic
1079996998 11:27305269-27305291 GGGACACCCTGCCTGCAGAGAGG + Intergenic
1079997008 11:27305339-27305361 GAGACGACCTGCCTGAAGAAAGG + Intergenic
1079997032 11:27305479-27305501 GGAATGACTTGCCTGTGGAAAGG + Intergenic
1080208293 11:29756153-29756175 AGGATGACCTGCCTGCGGAAAGG - Intergenic
1080485747 11:32704837-32704859 TGCACTACCTGCCTGCAGAAAGG + Intronic
1081044084 11:38250387-38250409 GGCACAACCTGTCTGCAGAAAGG - Intergenic
1081044095 11:38250461-38250483 AGGATGACCTGCCTGCAGAAAGG - Intergenic
1081082225 11:38756474-38756496 GGGATGACCTGCCTGTGGAAAGG - Intergenic
1081767326 11:45620786-45620808 GGGATAACCTGCCTGCAGAAAGG - Intergenic
1081767348 11:45620924-45620946 AGGATGACCTGCCTGCAGATAGG - Intergenic
1082731324 11:56801589-56801611 GGAATGACCTACCCACAGAATGG - Intergenic
1083916118 11:65744694-65744716 AGGATGACCTGTCTGCAGAAAGG + Intergenic
1083916131 11:65744763-65744785 GGAACAACCTGCCTGTAGAAAGG + Intergenic
1084469448 11:69348520-69348542 GGGATGACCTGCCTACAGAGAGG - Intronic
1084523693 11:69682894-69682916 GCACCCACCTGCCTGCGGAAGGG + Intergenic
1085100652 11:73797181-73797203 CAGACGACCTGCCTGCAGAGAGG + Intronic
1085334185 11:75678625-75678647 GGGAAGATCTGCCTGCAGAGAGG - Intergenic
1085403975 11:76250807-76250829 GGGATGACCAGCCTGCAGAAAGG + Intergenic
1085496919 11:76978459-76978481 GGGATGACCTGCCTGCAGATAGG + Intronic
1086092795 11:83020885-83020907 GGGATGACCTGCCCGCAGAGAGG + Intronic
1086092812 11:83021023-83021045 GGGACAACCTGCCTGCGGAGAGG + Intronic
1086249381 11:84795466-84795488 AGGATGACCTGCCTGCAGAGAGG + Intronic
1086268215 11:85028076-85028098 AGGACAACCTGCCTGCAGAAAGG - Intronic
1086268225 11:85028145-85028167 AGGACAACCTGCCTGCAGAAAGG - Intronic
1086508261 11:87528409-87528431 GGGATGACCTGCCTGCACAAAGG - Intergenic
1086947029 11:92853659-92853681 GGGACAACCTGCCTGCAGTAAGG - Intronic
1087037859 11:93772789-93772811 GGGACGACCTGCCTGCAGAGAGG - Intronic
1087131408 11:94672214-94672236 GGGATGACCTGCCTGCAGATAGG + Intergenic
1087407846 11:97752130-97752152 AGGATGACCTGCCTGCAGAAAGG - Intergenic
1087453385 11:98353135-98353157 GGGACGACCTGCCTGTGGAAAGG - Intergenic
1088287928 11:108206867-108206889 GGGACGACCTGCCTACGGAAAGG - Intronic
1088287952 11:108207022-108207044 AGGATGACTTGCCTGCAGAAAGG - Intronic
1088287959 11:108207089-108207111 GGGACAACCTGCCTGCAGAAAGG - Intronic
1088513332 11:110599936-110599958 GGGATGACCTGCCTGCAGAGAGG + Intronic
1088651155 11:111958851-111958873 GGGACGACCTGCCTGCGGAGAGG + Intronic
1089173000 11:116528126-116528148 GAGACGACCTGCCTGCAGAGAGG + Intergenic
1089173007 11:116528193-116528215 TGAAGGACCTGTCTGCAGAGAGG + Intergenic
1090116573 11:123979800-123979822 GGGGGGACCTGCCTGCAGAAAGG - Intergenic
1090514603 11:127412043-127412065 GGGATGACCTGCCTGCAGAGAGG - Intergenic
1090514619 11:127412138-127412160 GGGACCACCTTCCTGCAGACAGG - Intergenic
1092272016 12:7030985-7031007 GGGCCAACCTACCTGCAGAAAGG - Intronic
1092447066 12:8567785-8567807 TGAATGAACTGCCTGCAGAGAGG - Intergenic
1093183005 12:15988408-15988430 GGGATGACCTGCCTGCAGAAAGG - Intronic
1093183015 12:15988478-15988500 GGGACGACCTGCCTGCAAAAAGG - Intronic
1093317182 12:17666461-17666483 GGGTGGACCTGCCTGCAGAAAGG - Intergenic
1093492976 12:19725887-19725909 AGGACAACCTGCCTGCAGAAGGG - Intergenic
1093525677 12:20101839-20101861 GGGACAACCTGCCTGCTGAAAGG - Intergenic
1093764939 12:22952385-22952407 GGGAAGACCTGCCTGCGGAGAGG - Intergenic
1095145458 12:38721382-38721404 AGGACAACCTGCCTGCAGAGAGG + Intronic
1095603251 12:44037978-44038000 GGGATGCCCTGCCTGCAGATGGG + Intronic
1095727532 12:45469718-45469740 CAAATGACGTGCCTGCAGAAAGG + Intergenic
1095727545 12:45469789-45469811 GGGATGACCTGCCTATAGAAAGG + Intergenic
1096171957 12:49478948-49478970 GAGACGACCTGCCTACAGAGAGG - Intronic
1096355487 12:50937745-50937767 GGGATGTCCTGCCTGCAGAAAGG - Intergenic
1097076211 12:56396819-56396841 GGGATGACCTGCCTACAGAGAGG - Intergenic
1097076225 12:56396890-56396912 TGAATGACCTGCCTGCAGAGAGG - Intergenic
1097130824 12:56809733-56809755 AGGACAACCTGGCTGCAGAAAGG - Intergenic
1097130844 12:56809860-56809882 AGGATGACCTGCCTGCAGAGGGG - Intergenic
1097298936 12:57997796-57997818 AGAATGACCTGCCTGCAGAGAGG - Intergenic
1097360761 12:58655969-58655991 GGGACGACCCGCCTGCGGAAAGG - Intronic
1097360772 12:58656039-58656061 GGGACAACCTGCCTGCAGAAAGG - Intronic
1097500291 12:60392782-60392804 GGGACACCCTGCCTGCAGAGAGG + Intergenic
1097684256 12:62677069-62677091 GGGACAACCTGCCTGCAGATAGG + Intronic
1098671403 12:73235149-73235171 AGAACGACCTGCCTGTAGAAAGG - Intergenic
1098790598 12:74817126-74817148 GGGACAACTTGCCTGCAGAAAGG + Intergenic
1099033770 12:77560362-77560384 TGGATGACCTGCCTGCAGAAAGG + Intergenic
1099049728 12:77768030-77768052 GGAACAACCTGCCTGTCAAAAGG - Intergenic
1099321984 12:81162286-81162308 GGGATGACCTGCCTCCAGATAGG - Intronic
1099550057 12:84032868-84032890 GGAACTACCTGCCTTCAGTGGGG + Intergenic
1099560937 12:84173685-84173707 GGAATGACCTGCCTGCAGAAAGG - Intergenic
1099682357 12:85844507-85844529 GGGATGACTTGCCTGCAGAGAGG + Intergenic
1099682366 12:85844578-85844600 GGGACAACCTGCCTGCAGAGAGG + Intergenic
1100340981 12:93679055-93679077 TGACCGACCTGCCTGCAGGTAGG + Exonic
1100672768 12:96834937-96834959 GGGACACCCTGGCTGCAGAAAGG - Intronic
1101311801 12:103587300-103587322 GGTGAGACCTGCCTTCAGAAAGG - Exonic
1101478110 12:105070660-105070682 GGAATGAACTGAGTGCAGAAAGG + Exonic
1101580852 12:106039935-106039957 GGGATGACCTGCCTGCAGATAGG - Intergenic
1101580862 12:106040005-106040027 TGAGCAACCTGCCTGCAGATAGG - Intergenic
1102060482 12:109927239-109927261 GGGACGACCTGCCTACAGAGAGG + Intronic
1103173718 12:118843959-118843981 GGGAAGACCTGCCTGCAGAAAGG + Intergenic
1103403416 12:120658711-120658733 GGAACGGCCTGCATGCACAGTGG + Intronic
1104738085 12:131152243-131152265 GGGATGACCTGCCAGCAGAAAGG + Intergenic
1104742561 12:131189061-131189083 AAGACAACCTGCCTGCAGAAAGG + Intergenic
1105048571 12:133027732-133027754 GGGACCATCTGCCTGCAGAGAGG + Intergenic
1105837849 13:24226025-24226047 GGGACTACCTGCCTGCAGAGAGG - Intronic
1106325459 13:28684684-28684706 GGGACTACCTGCCTGCGGATAGG + Intergenic
1106576276 13:30978801-30978823 GAGATGACCTGCCAGCAGAAGGG - Intergenic
1106979053 13:35255961-35255983 GGGATGACCTGCCTGCGGAAAGG - Intronic
1106979075 13:35256099-35256121 GGGACAACCTGCCTGCAGATAGG - Intronic
1106979096 13:35256240-35256262 AGGATGACCTGCCTGCAGAAAGG - Intronic
1107147094 13:37070608-37070630 GGGACGACTTGCCTGCAGAGAGG + Intergenic
1107513605 13:41108027-41108049 GAGACGACCTGCCGGCAGAGAGG + Intergenic
1107699795 13:43036366-43036388 AGGATGACCTGCCTGCAGATAGG - Intronic
1107841179 13:44459254-44459276 GGAATGACCTGCCTGTGGAAAGG + Intronic
1107853511 13:44592457-44592479 GGGAGGACTTGCCTACAGAAAGG + Intergenic
1107875816 13:44789856-44789878 GGAAGGAAGTGCCTGCAGATTGG + Intergenic
1108240290 13:48457245-48457267 GGGACGACCTGCCTGCAGAGAGG - Intronic
1108249639 13:48551457-48551479 TGGTCAACCTGCCTGCAGAAAGG + Intergenic
1108844284 13:54659414-54659436 AGCACGACCTGCCTGCAGATAGG - Intergenic
1108854387 13:54775260-54775282 AGGAGGACCTGCCTGCAGAAAGG - Intergenic
1109029987 13:57179308-57179330 TGAACAACCTGCCTGGAGAGAGG - Intergenic
1109348512 13:61145818-61145840 AGGACAACCTGCCTGCAGAGAGG + Intergenic
1109420530 13:62105848-62105870 GGGATGACCTGCCTGCAGAAAGG + Intergenic
1109420540 13:62105918-62105940 GGATTGACCTGCCTGCAAAGAGG + Intergenic
1109426269 13:62168665-62168687 GTGAAGACCTGCCTACAGAAAGG + Intergenic
1109470663 13:62799657-62799679 GAGATGACCTGCCTGCAGAGAGG + Intergenic
1109603610 13:64663383-64663405 GGGATAACCTGCCTGCAGAAAGG + Intergenic
1109633675 13:65085665-65085687 GGGATGACCTGCCTGCAGAGAGG - Intergenic
1109687810 13:65843997-65844019 GGGACAACCTGCCTGTGGAAAGG + Intergenic
1109780799 13:67107502-67107524 AGAACGATCTGCCTGCAGAAAGG + Intronic
1109780811 13:67107571-67107593 GGGAGGACCTGCCTACAAAAAGG + Intronic
1109837481 13:67877998-67878020 GGGACAACCTGCCTGCACAGAGG + Intergenic
1109988158 13:70017010-70017032 TGGACAACCTGCATGCAGAAAGG + Intronic
1110201178 13:72851815-72851837 TGGACGATCTGCCTGCAGAGAGG + Intronic
1110810697 13:79808121-79808143 GGGATGACCTGCCTGCAGAGAGG + Intergenic
1110915203 13:81012406-81012428 GGAACCCACTGCCTGCAGGAAGG - Intergenic
1110980359 13:81889715-81889737 GGGAAAACTTGCCTGCAGAAAGG + Intergenic
1110999664 13:82164081-82164103 GGAAAGACTTGCCTGCAGAGAGG - Intergenic
1111002478 13:82204178-82204200 GGAAATCCCTGCCTCCAGAACGG + Intergenic
1111072126 13:83183531-83183553 GGGATGACCTGACTGCTGAAAGG - Intergenic
1111119279 13:83824260-83824282 AGGATGACCTGCTTGCAGAAAGG + Intergenic
1111202582 13:84959897-84959919 GGAATGACCTGCCTGCAGAAAGG - Intergenic
1111202799 13:84961820-84961842 GAGATGACCTGCATGCAGAAAGG - Intergenic
1111243771 13:85508576-85508598 GGGACAACCTGCCTGCATAAAGG + Intergenic
1111268868 13:85854015-85854037 GGGATGACCTGCCTGCAGAAAGG + Intergenic
1111304028 13:86382811-86382833 GGGACGACCTGCCTGCAAAAAGG + Intergenic
1111347327 13:86975111-86975133 GGGATGACCTGCCTGTGGAAAGG + Intergenic
1111505750 13:89185905-89185927 GGGACAACCTGCCTGGAGAGAGG + Intergenic
1111512634 13:89287043-89287065 GGGATGACCTGGCTGCAGAGAGG - Intergenic
1111549069 13:89783883-89783905 GGGATGACCTGCCTGCAGAAAGG - Intergenic
1111549080 13:89783953-89783975 GGGATGACCTGCCTGTAGAGAGG - Intergenic
1111597319 13:90428122-90428144 GGGATGATCTGCCTGCAGATAGG + Intergenic
1114980480 14:28157988-28158010 AGGATGACCTGCCTGCTGAAAGG - Intergenic
1115059146 14:29169054-29169076 GGGACAACCTGCCCGCAGAAAGG + Intergenic
1115345256 14:32335981-32336003 GGAACTACCTTGCTGGAGAAGGG - Intronic
1115443415 14:33462231-33462253 GGAAGGAACTGCGTCCAGAAAGG - Intronic
1116159719 14:41253398-41253420 GGGATGACCTTCCTGCAGAAAGG - Intergenic
1116167305 14:41350166-41350188 TGGACGACCTGCCTGCAGAAAGG + Intergenic
1116221649 14:42095784-42095806 GGGATGGCCTGCCTGCAGAGAGG - Intergenic
1116356775 14:43939432-43939454 GGGACGACTTACCTGCAGAAAGG + Intergenic
1116356783 14:43939502-43939524 AGGATGACCTGCCTGCAGAAAGG + Intergenic
1116789957 14:49329697-49329719 GGGATGACCTGCCTGCAGAAAGG - Intergenic
1117512730 14:56470153-56470175 GGAGCTAGCTGCCTGCAGACGGG - Intergenic
1117734043 14:58751458-58751480 AGGACAACCTGCCTGCAGAGAGG + Intergenic
1118344221 14:64923991-64924013 GGTAATACCTGCCTGGAGAATGG + Exonic
1119219549 14:72894759-72894781 GGAAAGCCCTGGCTGCAGGAGGG - Intergenic
1119257125 14:73208378-73208400 GGGACGACCTGCCTGCAGATAGG - Intronic
1119257136 14:73208448-73208470 AGGATGACCTGCCTGCAGACAGG - Intronic
1119618249 14:76112570-76112592 TGGACAACCTGCCTACAGAAAGG + Intergenic
1120299399 14:82687122-82687144 GAAACGATCTGGTTGCAGAAGGG + Intergenic
1120592335 14:86390718-86390740 AGGACAACCTGCCTGCTGAAAGG + Intergenic
1120751816 14:88204596-88204618 GCAACTACCTGCCTGCAGCGGGG - Intronic
1121695298 14:95907660-95907682 GGGATGACCTGCCTACAGAGAGG - Intergenic
1121743917 14:96273172-96273194 GGAAGTACCTGACTGCAGATTGG + Intergenic
1122386044 14:101348995-101349017 GGGACAACCTGACTGCAGAAAGG - Intergenic
1202840233 14_GL000009v2_random:114567-114589 GGGATGACCTGCCTGCAGAAAGG + Intergenic
1202909614 14_GL000194v1_random:104764-104786 GGGATGACCTGCCTGAAGAAAGG + Intergenic
1202883672 14_KI270722v1_random:84538-84560 GGGATGACCTGCCTGCAGAAAGG - Intergenic
1123888395 15:24749583-24749605 GGAATGACCTGCTTGCAGAGAGG + Intergenic
1124937636 15:34187306-34187328 TGGACGACCTGCCTACAGAGAGG + Intronic
1125862097 15:43008831-43008853 GGGATGACCTGCCTGTGGAAAGG + Intronic
1126111393 15:45177006-45177028 GGAAACACAAGCCTGCAGAATGG - Intronic
1126156839 15:45573915-45573937 GGGACGACCTGCCCACAGAGAGG - Intergenic
1126260238 15:46681058-46681080 GGAAAGACCTGGCTGCATCAAGG - Intergenic
1126472452 15:49028486-49028508 GCAACAACCAGCCTGCAGCAGGG - Exonic
1126979602 15:54227154-54227176 AGAACGATCTGCCTGAGGAAAGG - Intronic
1127017721 15:54707938-54707960 AGAACGATCTGCCGGCAGAGAGG - Intergenic
1127525881 15:59791815-59791837 AGGACAACCTGCCTGCAGAGAGG - Intergenic
1128790670 15:70431570-70431592 TGAATGACCTGCCTGCAGAGAGG - Intergenic
1129368995 15:75076296-75076318 AGGACGACCTGCCTACAGAGAGG - Intronic
1129369007 15:75076367-75076389 AGAGTGACCTGCCTGCAGAGGGG - Intronic
1130183203 15:81651977-81651999 GGAATGACCTGCCTGCAGAGAGG + Intergenic
1130856078 15:87841186-87841208 GGGACAACCTGCCTACAGAGAGG - Intergenic
1131568289 15:93506220-93506242 TGGACGACCTGCCTACGGAAAGG - Intergenic
1131605655 15:93900484-93900506 GAGACAACCTTCCTGCAGAAAGG - Intergenic
1131605658 15:93900508-93900530 GGGACAACCTTCCTGCGGAAAGG - Intergenic
1131632688 15:94195933-94195955 TGAAGGATCTGCCTTCAGAAGGG + Intergenic
1131999200 15:98162710-98162732 CGGACAACCTGCCTGCAGAAAGG - Intergenic
1131999209 15:98162764-98162786 CGGACAAGCTGCCTGCAGAAAGG - Intergenic
1133317010 16:4891142-4891164 GGCACGAGCTGCCTGCTGCAGGG - Intronic
1133739086 16:8638228-8638250 GGAGCTCCCTGCTTGCAGAAGGG - Intronic
1136452142 16:30359470-30359492 GCAAGGACCTGCCTGCAGCCTGG + Intronic
1137334280 16:47533049-47533071 GGGATGACCTGCTTGCAGAGGGG - Intronic
1137343936 16:47637089-47637111 GGGATGAGCTGCCTGCAGAAAGG + Intronic
1137588681 16:49680183-49680205 AGCTGGACCTGCCTGCAGAAAGG + Intronic
1137692976 16:50441968-50441990 GGGCCAACCTGCCTGCAGAGAGG + Intergenic
1137825229 16:51489248-51489270 AGGACGACCTGCCTACAGAGAGG - Intergenic
1138033486 16:53579793-53579815 AGGACGACCTGCCTACAGAGAGG - Intergenic
1138033495 16:53579863-53579885 GGGATGACCTGTCTGCAGAGAGG - Intergenic
1138394856 16:56695956-56695978 AGGACAACCTGCCTGCAGAGAGG + Intronic
1138925077 16:61581214-61581236 GGGATGACCTGCCTGCAGAAAGG - Intergenic
1139138550 16:64233795-64233817 GGGACGACCTGCCTGCAGATAGG + Intergenic
1139148022 16:64345765-64345787 GGGATGGCCTGCCTGCAGAAAGG + Intergenic
1139148031 16:64345835-64345857 AAGAGGACCTGCCTGCAGAAAGG + Intergenic
1139458729 16:67105406-67105428 GGAAGCACTTGCCTTCAGAAAGG + Intergenic
1140103525 16:71938683-71938705 AGGATGACCTGCCTGCAGATAGG + Intronic
1140103536 16:71938750-71938772 GGGACGACCTGCCTGTGGATAGG + Intronic
1140419510 16:74807095-74807117 GGGATGACCTGCCTACAGAGAGG - Intergenic
1142593515 17:1018416-1018438 GGAGAGACCTGCCTCAAGAAGGG - Intronic
1142759933 17:2036233-2036255 GGAAAGATCTACCTGCAGAGCGG - Intronic
1144060893 17:11582816-11582838 GGAGTGACCTGCCTGAAGATAGG - Intergenic
1144553364 17:16260590-16260612 GGGATGACCTGCCTGTGGAAGGG + Intronic
1144553372 17:16260660-16260682 GGGATGACCTGCTTGCAGAAAGG + Intronic
1145879620 17:28343819-28343841 GGCATGACCTGCCTGGAGGAAGG - Intronic
1146124725 17:30222516-30222538 GGACTGTCCTGCCTGCTGAAAGG - Intronic
1146359212 17:32160168-32160190 GGGATGACCTGCCTGCAGAGAGG + Intronic
1146425341 17:32732497-32732519 GGGACGACCTGCCTGCAGAGAGG + Intronic
1146425349 17:32732571-32732593 GGGAGGACCTGACTGCAGAGAGG + Intronic
1146761572 17:35483224-35483246 GGGATGACCTGCCTACAGAGAGG + Intronic
1147540302 17:41351748-41351770 GGGACGGCCTGTCTGAAGAAGGG - Intergenic
1148640358 17:49183148-49183170 TGGACGACCTGCCTGCAGAGAGG - Intergenic
1148858775 17:50593322-50593344 GGCAGGAGCTGCCTTCAGAAGGG - Intronic
1149169486 17:53792405-53792427 AGGATGACCAGCCTGCAGAAAGG + Intergenic
1149329897 17:55570019-55570041 GGGATGACCTGCCTGCAGAGAGG + Intergenic
1150201488 17:63362148-63362170 GGGACAACCTGCCTGTAGATAGG - Intronic
1150201500 17:63362218-63362240 GAGACAACCTGCCTGCAGATAGG - Intronic
1150357153 17:64496627-64496649 GGAAGAACCTGGCCGCAGAATGG - Exonic
1150521083 17:65866734-65866756 GGGACAACCTGCCTGCAGAGAGG + Intronic
1150529230 17:65959306-65959328 GGGACACCCTGGCTGCAGAAAGG + Intronic
1150952848 17:69822074-69822096 AGGATGACCTGCCTGCAGAGAGG + Intergenic
1150952858 17:69822145-69822167 GGGACACCCTGGCTGCAGAAAGG + Intergenic
1151010004 17:70483607-70483629 GGGAAGACCTGCCCACAGAAAGG - Intergenic
1152530383 17:80915039-80915061 GGCATAACCTGCCTTCAGAAAGG + Intronic
1152864204 17:82712613-82712635 AGGATGACCTGCCTGCAGAGAGG - Intergenic
1153553873 18:6290252-6290274 GGAACAATCAGACTGCAGAAGGG + Intronic
1154357462 18:13632849-13632871 AGGATGACCTGCCTACAGAAAGG - Intronic
1154357481 18:13632971-13632993 AGGATGACCTGCCTACAGAAAGG - Intronic
1154357500 18:13633089-13633111 GGCATGACCTGCCTGAGGAAAGG - Intronic
1156244388 18:35284021-35284043 GGGACAAGCTGCCTGCAGAGAGG - Intronic
1156327314 18:36085817-36085839 GGGATGACCTGCCTGCAGAGAGG + Intergenic
1157506695 18:48231371-48231393 AGGACAACCTGCCTGCAGAGAGG + Intronic
1158198044 18:54910300-54910322 GGGACAACCTGCCTGCAGAGAGG - Intronic
1158383910 18:56967233-56967255 GGCAAGAACAGCCTGCAGAAAGG - Intronic
1158788055 18:60740014-60740036 GGGAAGCCCTGCCTGCAGAGAGG + Intergenic
1159186712 18:64984247-64984269 GAAATGACCTGCCTGCAGGGAGG + Intergenic
1160083541 18:75753580-75753602 AGGATGACCTGCCTGCAGAAAGG - Intergenic
1160116595 18:76084828-76084850 GGGACAACCTGCCTGGAGAAAGG - Intergenic
1160292886 18:77609888-77609910 CGGACGACCTGCCTACAGAGGGG + Intergenic
1160474138 18:79167439-79167461 AGAACGACCTGCCTGCTGATAGG - Intronic
1160924881 19:1539218-1539240 GGAGCGCTCTGCCTGCAGATGGG - Intergenic
1161780234 19:6286849-6286871 GGCACAACCTGCTTGCAGAGAGG + Intergenic
1164301684 19:23967684-23967706 AGAAAGGGCTGCCTGCAGAAAGG - Intergenic
1164603131 19:29577191-29577213 GGAAGGACCTGCCTGCGGACAGG - Intergenic
1164711400 19:30359550-30359572 GGAACCAGATGCCTGCAGAGGGG - Intronic
1165022695 19:32936903-32936925 GGGACGACCTGCCTACAGAGAGG + Intronic
1165026909 19:32969042-32969064 GGAATGACTTGCCTGCGGAGAGG - Intronic
1165096872 19:33414241-33414263 GGAACGAGCTGCCTGCTGGCTGG + Intronic
1166416245 19:42596455-42596477 GGCAGGAGCTGCCTGCAGAGGGG + Intronic
1166897526 19:46033171-46033193 GGGATGATCTGCATGCAGAAAGG + Intergenic
1168516881 19:57016504-57016526 GGTACAACCTGACTGCAGAGGGG - Intergenic
1202632823 1_KI270706v1_random:15990-16012 GGGATGACCTGCCTGCAGAAAGG - Intergenic
1202653055 1_KI270707v1_random:24059-24081 GGGATGACCTGCCAACAGAAAGG + Intergenic
1202659097 1_KI270708v1_random:51686-51708 GGGATGACCTGCCTGCAGAAAGG - Intergenic
925619944 2:5782111-5782133 AGTACAACCTCCCTGCAGAAGGG - Intergenic
926070472 2:9884613-9884635 AGGACGACCTGCCTGCAGACAGG - Intronic
926546265 2:14244602-14244624 GGAATGACCTGCCTGCGGATAGG + Intergenic
926547000 2:14254955-14254977 GAGACGACTTGCCTGCAGATAGG - Intergenic
926958794 2:18332005-18332027 GGGAGGACCTGCCTGCAGAGAGG - Intronic
926958808 2:18332127-18332149 GGAATGACCTGCCTGCAGAGAGG - Intronic
927266850 2:21161823-21161845 GGGATGACCTGCCTACAGAGAGG - Intergenic
927266873 2:21162003-21162025 GGAACAACCTGCCTGCAGAGAGG - Intergenic
927613527 2:24566221-24566243 GGGACACCCTGGCTGCAGAAAGG - Intronic
927955414 2:27204374-27204396 GGAAAGGACTGACTGCAGAAAGG - Intronic
928723568 2:34147265-34147287 GGGAGGACCTGCCTGCAGACAGG - Intergenic
928723580 2:34147332-34147354 GGGACGACCTGCCTGCAAAGAGG - Intergenic
928796956 2:35034413-35034435 GGGATGACTGGCCTGCAGAAAGG - Intergenic
928823469 2:35391434-35391456 TGTACGACCTGCCTGAGGAACGG - Intergenic
929847087 2:45541580-45541602 GGGACAACCTGCCTGCGGAAAGG - Intronic
929847100 2:45541650-45541672 GGGATAACCTGCCTGCAGAAAGG - Intronic
930313600 2:49771694-49771716 GGGATGACCTGCCAGCAGAAAGG - Intergenic
930800603 2:55438782-55438804 AGGACGACCTGCCTGCAGACAGG + Intergenic
931300524 2:60973963-60973985 AGGACGACCTGCCTGCAGAGAGG + Intronic
931300533 2:60974075-60974097 AGGACGACCTGCCTGCACAGAGG + Intronic
931733861 2:65177033-65177055 TGGACAACCTGCCTGCAGAGAGG - Intergenic
932054689 2:68432435-68432457 AGGATGACCTGCCTGCAGAGAGG - Intergenic
932054695 2:68432491-68432513 AGGATGACCTGCCTGCAGAGAGG - Intergenic
932054719 2:68432689-68432711 GGGATGACCTGCCTGCAGAGAGG - Intergenic
932398222 2:71462682-71462704 AGGAGGACCTGCCTGCAGAAAGG - Intronic
932501610 2:72187563-72187585 GAGACAACCTGCCTGCAGAGAGG - Intronic
932571353 2:72940099-72940121 GGAGTGACCTGGCTGCAGAGTGG - Intergenic
932644603 2:73487781-73487803 AGGATGACCTGCCTGCAGAAAGG - Intronic
932644622 2:73487920-73487942 GGAATGACCTGCCTGCAGATAGG - Intronic
933093337 2:78147036-78147058 GGGACAACCTGCCTGCAGAGAGG + Intergenic
933219243 2:79669682-79669704 GAGACGACCTGCCAGCAGAGAGG - Intronic
933624662 2:84585554-84585576 GGGACAACCTGCCTGCAGAGAGG - Intronic
934696487 2:96404293-96404315 GAAACAACCTCCCTGCAGAGGGG - Intergenic
934699915 2:96430860-96430882 GGGATGATCTGCCTGCAGAGAGG + Intergenic
934699926 2:96430931-96430953 GGGATGACCTGCCTGCAGAGAGG + Intergenic
935518723 2:104078102-104078124 GGAATGACCTGCCTGTAGAGAGG - Intergenic
935667584 2:105525831-105525853 GGGACGACCTGCTTGTGGAAAGG + Intergenic
937167849 2:119837354-119837376 GGGTCGACCTGCCTGTGGAAAGG + Intronic
937167863 2:119837424-119837446 TGGACGACCTGCCTGTGGAAAGG + Intronic
937370807 2:121296072-121296094 GGGATGACCTGCCTGCGGAAAGG - Intergenic
937438544 2:121898265-121898287 GCAACGACCTCCCAGCAGCATGG - Intergenic
937737879 2:125313569-125313591 GGGATGACCTGCCTGCGGAAAGG + Intergenic
939017604 2:136920349-136920371 GGGACGACTTGCCTGTGGAAAGG - Intronic
939017616 2:136920419-136920441 GAGATGACCTGCCTACAGAAAGG - Intronic
939801899 2:146720888-146720910 GGGACTACCTGCCTGCAGAAAGG + Intergenic
940422805 2:153499276-153499298 GTGATGACCTGCCTGCAGAAAGG - Intergenic
940441106 2:153717292-153717314 GGAATGAAATCCCTGCAGAATGG - Intergenic
940582582 2:155600735-155600757 AGGACGACCTGCCTGCAGAAAGG - Intergenic
940612168 2:156006197-156006219 GGGACACCCTGGCTGCAGAAAGG - Intergenic
940956922 2:159738554-159738576 GGGATGACCTGCCTGTGGAAAGG - Intronic
941260579 2:163291851-163291873 GCACCGACCTCCCTGCAGAGTGG - Intergenic
941404855 2:165075095-165075117 GGGACTACCTGCCTGGAGAAAGG + Intergenic
942104040 2:172614579-172614601 TGAATGACTTGCCTGCAGAGAGG + Intergenic
942114305 2:172712963-172712985 CGGACAGCCTGCCTGCAGAAAGG - Intergenic
942114315 2:172713033-172713055 AGAAAGACCTGCCTGCAGATAGG - Intergenic
942114337 2:172713179-172713201 AGGACGACCTCCCTGCAGAGCGG - Intergenic
943023429 2:182601659-182601681 GGAACATCCTAGCTGCAGAAAGG - Intergenic
943064143 2:183069438-183069460 GGGACAACCTGCCTGCAGAAAGG + Intergenic
943179417 2:184524493-184524515 AGTATGACCTGCCTGCAGAGAGG - Intergenic
943858451 2:192828563-192828585 GGGACGACCTGCCTGCGGAGAGG + Intergenic
943928464 2:193819416-193819438 GGGATGAGATGCCTGCAGAAAGG - Intergenic
943960253 2:194254679-194254701 GGGGTGACCTGCCTGCAGAAAGG + Intergenic
943960263 2:194254747-194254769 GGGATGACCTGCCTGCAGAAAGG + Intergenic
943965596 2:194328124-194328146 GGGACAACCAGCCTGCAGAGAGG + Intergenic
943965606 2:194328188-194328210 GGGACAACCAGCCTGCAGAGGGG + Intergenic
944146791 2:196514741-196514763 GGGACGACCTGCTTGCAGAAAGG + Intronic
944483872 2:200182806-200182828 GGGACAACCTGCCTACAGAGAGG + Intergenic
944901780 2:204223269-204223291 GGGATGACCTGCCTGCAGAGAGG - Intergenic
945721352 2:213421838-213421860 AGGACGACCTGCCCGCAGAAAGG + Intronic
946495630 2:220192720-220192742 GGGATGACCTGCCTGTGGAAAGG + Intergenic
947316728 2:228866747-228866769 GGGACGACTTGCCTACAGAGAGG + Intronic
1169880537 20:10341895-10341917 AGGACTACCTGCCTGCAGAAAGG + Intergenic
1170043837 20:12065419-12065441 AGGACGACCTGCCTGCAGAAAGG - Intergenic
1170221594 20:13947350-13947372 GGGATGACCTGCCTGCAGATGGG + Intronic
1170221602 20:13947418-13947440 AGGACCACCTGCCTGCGGAAAGG + Intronic
1170314889 20:15031519-15031541 AGGACGACCTGCCTGAGGAAAGG - Intronic
1170501067 20:16975364-16975386 GGGACAAGCTGCCTGCAGAGAGG + Intergenic
1170501075 20:16975421-16975443 GGGACACCCTGGCTGCAGAAAGG + Intergenic
1171286046 20:23938711-23938733 GGGCTGACCTGCTTGCAGAAAGG + Intergenic
1171329192 20:24322701-24322723 TGAAAGAACTGCCTGCAAAAGGG - Intergenic
1172676746 20:36677718-36677740 TGGACGACCTGCCTACAGAGAGG + Intronic
1173252741 20:41373290-41373312 GGACAGACCTGCATGCAGAGGGG + Intergenic
1173718586 20:45233172-45233194 CGAACACCCTGCCTGCAGAGAGG + Intergenic
1173740116 20:45394415-45394437 GGGACTACCTGCCTGCAGATAGG + Intronic
1175064401 20:56272799-56272821 GGGATGACCTGCCTGCAGAGAGG + Intergenic
1176408465 21:6434637-6434659 GGGACACCCTGGCTGCAGAAAGG + Intergenic
1176599098 21:8775592-8775614 GGGATGACCTGCCTGCAGAAAGG - Intergenic
1176628964 21:9119472-9119494 GGGATGACCTGCCTGCAGAAAGG + Intergenic
1176645038 21:9341870-9341892 GGGATGACCTGCCTGCCGAAAGG - Intergenic
1177037396 21:16060781-16060803 GGGATGGCCTGCCTGCAGATAGG - Intergenic
1177262629 21:18750230-18750252 AGGACAACCTGCCTGCAGAGAGG + Intergenic
1177344614 21:19853748-19853770 GGGACGAGCTGCCTGGGGAAAGG - Intergenic
1177404360 21:20646075-20646097 GGGATGACCTGCCTGCAGAATGG + Intergenic
1177624839 21:23646419-23646441 GGGACAACCTGCTTGCAGAGAGG - Intergenic
1177875353 21:26625670-26625692 GGAACTACCTGCCTGTGGACAGG - Intergenic
1178937442 21:36875470-36875492 GGGACAACCTGTCTGCAGAAAGG + Intronic
1178937462 21:36875610-36875632 GGGACGATCTGCCTGCAGGAAGG + Intronic
1179683958 21:43042963-43042985 GGGACACCCTGGCTGCAGAAAGG + Intergenic
1180041253 21:45281472-45281494 GGAGCCACCTGCCTTCACAAAGG + Intronic
1180178890 21:46109070-46109092 GGGATGACCTGCCTGCAGAGAGG - Intronic
1180326557 22:11435202-11435224 GGGATGACCTGCCTGCAGAAAGG - Intergenic
1180367914 22:11957364-11957386 GGGATGACCTGCCTGCAGAAAGG + Intergenic
1180378175 22:12113972-12113994 GGGATGACCTGCCTGCAGAAAGG - Intergenic
1180419332 22:12799309-12799331 TGGATGACCTGCCTGCAGAAAGG + Intergenic
1181991020 22:26836863-26836885 GGCAAGACCTGCCTGCAGCCTGG - Intergenic
1182062014 22:27405140-27405162 GGAAGGACCAGCCTGCGCAAAGG - Intergenic
1183818112 22:40321108-40321130 AGAACGATCTGCATGCAGCATGG + Exonic
1184054221 22:42033621-42033643 AGGAAGACCTGCCTGCAGATAGG - Intronic
1184298926 22:43543562-43543584 GGATCGACATCCTTGCAGAATGG + Intronic
1184665727 22:45987937-45987959 AGAATAACCTGCCTGCAGAGAGG + Intergenic
1184858378 22:47158827-47158849 GGCAGGACCTGCGTCCAGAAAGG + Intronic
1184869398 22:47225748-47225770 GGGATGACCTGCCTGCAGACAGG - Intergenic
1185195623 22:49467559-49467581 GGAAGGAGCGGCCTGCAGGAAGG + Intronic
949226373 3:1700061-1700083 GGGAAGATCTGCCTGCAGAAGGG + Intergenic
949226410 3:1700341-1700363 ATGACAACCTGCCTGCAGAAAGG + Intergenic
950994503 3:17480628-17480650 AGGACAACCTGCTTGCAGAAAGG + Intronic
950994512 3:17480698-17480720 GGGACTACCTGCCTTCAGAAAGG + Intronic
951136171 3:19106924-19106946 GGGATGACCTGCCTGCAGAAAGG - Intergenic
951264679 3:20552269-20552291 AGGATGACCTGCCTGCAGAGAGG - Intergenic
951508861 3:23479723-23479745 GGGACAAGCTGCCTGCAAAAAGG - Intronic
951509624 3:23486711-23486733 GGTACAACCTGCCTGCTGAAAGG - Intronic
951718430 3:25673613-25673635 GGAACAACCTGCCTGCAGAGAGG - Intergenic
952016168 3:28959407-28959429 TGAATGACCTGCCTGCAGATAGG + Intergenic
953289876 3:41650036-41650058 GGGACAACCTGCCTGTGGAAGGG + Intronic
953603105 3:44387214-44387236 GGGACAACCTGCTGGCAGAAAGG + Intronic
953748138 3:45590857-45590879 GGGACAACCTGCCTGAGGAAAGG - Intronic
953748162 3:45590994-45591016 GGGATGACCTGCCTGCAGATAGG - Intronic
953766606 3:45747724-45747746 GGAACACCCTGGCTGCGGAAAGG + Intergenic
953787233 3:45920465-45920487 GGAACCAGCTGCCTGCAGTCAGG - Exonic
953802083 3:46031902-46031924 GGGATAACCTGCCTGCAGAGAGG + Intergenic
953802095 3:46031973-46031995 GGGACACCCTGGCTGCAGAAAGG + Intergenic
954099316 3:48357375-48357397 GGGACAATCTGCCTGCAGAGAGG - Intergenic
954650858 3:52161976-52161998 TGAATGACTTGCCTGCAGAGAGG - Intergenic
954856001 3:53643866-53643888 GGAACACCCTGCCTGGAGCAGGG + Intronic
955482656 3:59405003-59405025 GGAACAACCTGCCAGAATAATGG - Intergenic
956462259 3:69484554-69484576 GGGATGACCTGCCTACAGATAGG - Intronic
957095292 3:75772175-75772197 GGGATGACCTGACTGCAGAAAGG + Intronic
957156526 3:76551332-76551354 AGGACAACCTGCCTGCAGAAAGG + Intronic
957307800 3:78480773-78480795 GGGATGACCTGCCTGTGGAAAGG + Intergenic
957417931 3:79929841-79929863 GGGACAACCTGCCTGTTGAAAGG + Intergenic
957614081 3:82505942-82505964 GGGACGACCTGCCTGTGGAAAGG + Intergenic
957614545 3:82509845-82509867 TGGACGACTTGCCTGCAGATGGG + Intergenic
957636374 3:82790887-82790909 GGGACGACCTGCCTGCAGAGAGG + Intergenic
957775839 3:84756663-84756685 GGGATGACCTGCCTGCAGGTAGG - Intergenic
957775852 3:84756759-84756781 GGGATGACCTGCCTGCAGGTAGG - Intergenic
958019304 3:87978653-87978675 GGGATGACCTGCCTGGGGAAAGG - Intergenic
958141767 3:89571203-89571225 GGGACGACCTGCCTACAGATAGG - Intergenic
958141779 3:89571275-89571297 ACGACAACCTGCCTGCAGAAAGG - Intergenic
958161180 3:89818419-89818441 AGAATGACCTGGCTCCAGAATGG - Intergenic
958498356 3:94874529-94874551 GGGACGACCTGTTTGCAGAAAGG - Intergenic
958498366 3:94874598-94874620 GGGACAACTTGCCTTCAGAAAGG - Intergenic
958562003 3:95759381-95759403 GGGATGACCTGCCTGTTGAAAGG - Intergenic
958572909 3:95911376-95911398 GGGATGACCTGCCTGCAAAGAGG - Intergenic
958678047 3:97292506-97292528 AGGACGACCTGCTTGCCGAAAGG - Intronic
958678116 3:97292930-97292952 GAGATGACCTGCCTGCAAAAAGG - Intronic
958678124 3:97293000-97293022 AGGATGACCTGCCTGAAGAAAGG - Intronic
958678205 3:97293488-97293510 GGGGTGACCTGCCTGTAGAAAGG - Intronic
959252570 3:103966430-103966452 GGGATGACCTGCCTGCAAATAGG + Intergenic
959389699 3:105759144-105759166 GGGATGATCTGCCTGCAGAAAGG - Intronic
959863634 3:111242660-111242682 AGGACAACCTGCCTGCAGAGAGG - Intronic
960011103 3:112835311-112835333 GGGATGACCTGCCTGCAGAGAGG - Intronic
960690653 3:120342611-120342633 GGGACCACCTGCCTACAGAGAGG + Intronic
961493657 3:127274977-127274999 GGGACAACCTGCCTACAGAGAGG + Intergenic
962824488 3:139088154-139088176 GGGACACCCTGGCTGCAGAAAGG - Intronic
962824509 3:139088339-139088361 GGGATGACCTGCCTGCAGAGAGG - Intronic
963016319 3:140827714-140827736 AGAGGGACCTGCATGCAGAAAGG - Intergenic
963250238 3:143096049-143096071 GGGATGTCCTGCCTGCAGATAGG + Intergenic
963346310 3:144099573-144099595 AGGATGACCTGGCTGCAGAAAGG + Intergenic
963454222 3:145522893-145522915 GGGATGACCTGCCTGCAGAGAGG - Intergenic
963454242 3:145523074-145523096 GGGATGGCCTGCCTGCAGAGAGG - Intergenic
964075141 3:152684225-152684247 GGGATGACCTGCCTGTGGAAAGG - Intergenic
964075153 3:152684295-152684317 GGGACTATCTGCCTGCAGAAAGG - Intergenic
964075179 3:152684430-152684452 GGGATGACCTGCCTGTGGAAAGG - Intergenic
964590688 3:158360173-158360195 GGGAGGACCTGCCTACAGAGAGG - Intronic
964927251 3:161974772-161974794 AGGACAACCTGCCTGCAGATAGG - Intergenic
965013957 3:163131857-163131879 GGAACAACCTGCCTGCTGAAAGG + Intergenic
965061281 3:163788258-163788280 GGGATGCCCTGCCTGCAGAAAGG - Intergenic
965087244 3:164114230-164114252 GGGATGACCTGCCTGCAGAGAGG + Intergenic
965229168 3:166028909-166028931 GGGACAACCTGCCTACAGATAGG - Intergenic
965229178 3:166028974-166028996 CTACCTACCTGCCTGCAGAAAGG - Intergenic
965229203 3:166029183-166029205 AGGACAACCTGACTGCAGAAAGG - Intergenic
965272760 3:166639099-166639121 GGGACAATCTGCCTGCAGAGAGG + Intergenic
965367798 3:167820971-167820993 AGGATGACCTGCCTGCAGAGAGG + Intronic
965367809 3:167821041-167821063 GGGACAACCCGCCTGCAGAGAGG + Intronic
965813363 3:172614016-172614038 GGGATGACCTGCCTGCAAAGAGG - Intergenic
967444795 3:189554583-189554605 AGAACAACCTGACTGCAGAGAGG - Intergenic
967649844 3:191973280-191973302 GGGATGACCTGCCTGCAGAGAGG - Intergenic
968142928 3:196273592-196273614 AGGATGACCTGCCTGCAGATAGG - Intronic
968142940 3:196273662-196273684 GGGATGACCTGCCTGCGGATAGG - Intronic
1202741853 3_GL000221v1_random:63198-63220 GGGATGACCTGCCTGCCGAAAGG + Intergenic
968838293 4:2981427-2981449 GGGATGATCTGCCTGCAGAAAGG - Intronic
968838306 4:2981497-2981519 AGGACAACCTGCCTGCAGATAGG - Intronic
968838318 4:2981567-2981589 AGGACAACCTGCCTGCAGAGAGG - Intronic
970501172 4:16678669-16678691 GGAGAGAACTGTCTGCAGAAAGG + Intronic
971012683 4:22456348-22456370 GGAAGGACCTGCCCTCAGTATGG + Intronic
971669779 4:29542403-29542425 AGGATGACCTGCCTGCAGAAAGG - Intergenic
971714044 4:30153083-30153105 GGAATGACCTGCTTACAGAGGGG - Intergenic
971834604 4:31747754-31747776 GGGACGACCTGCTGGCGGAAAGG - Intergenic
971867424 4:32190350-32190372 GGGATGACTTGCCTGCAGAAAGG + Intergenic
971938770 4:33188476-33188498 GGGAGGACCTGCTTGCAGAGAGG - Intergenic
972075289 4:35079450-35079472 GGGATGACCTGCCTGCAGATAGG + Intergenic
972106508 4:35494733-35494755 GAGATGACCTGCCTGCAGAGAGG + Intergenic
972203974 4:36748360-36748382 GGGACGACCTGCCTGTAGAGAGG + Intergenic
973026863 4:45284013-45284035 GGGACGACCTGTCTGTGGAAAGG - Intergenic
973041204 4:45472199-45472221 GGGACACCCTGCCTACAGAAAGG + Intergenic
973362454 4:49177964-49177986 GGGATGACCTGCCTGCAGAAAGG - Intergenic
973398646 4:49618897-49618919 GGGATGACCTGCCTGCAGAAAGG + Intergenic
973534502 4:51867608-51867630 AGGACAACCTGCCTGCAGATAGG - Intronic
974229586 4:59092166-59092188 AGGCTGACCTGCCTGCAGAAAGG + Intergenic
974235856 4:59180134-59180156 AGTATGACCTGCCTGCAGACAGG + Intergenic
974420170 4:61662830-61662852 GGAATGACCTGCCTGTGGAGAGG + Intronic
974432605 4:61817454-61817476 GGGATGACCTGCCTGCAGAAGGG + Intronic
974628935 4:64458117-64458139 GAGATGACCTGCCTGCAGAAAGG + Intergenic
974683467 4:65194838-65194860 GGGACAACCTGACTGCAGAGAGG - Intergenic
974686784 4:65241829-65241851 GGGACAACCCGCCTGCGGAAAGG - Intergenic
974697964 4:65398746-65398768 GGGACAACATGCCTGCAGATAGG + Intronic
974697972 4:65398812-65398834 GGGATGATCTACCTGCAGAAAGG + Intronic
974894882 4:67926866-67926888 GGGACTACCTGCCTGCAGAGAGG + Intronic
974894891 4:67926945-67926967 AGGACAACCTGCCTGCAGAGAGG + Intronic
974972204 4:68844428-68844450 GGGACTACCTGCCTACAGAGAGG - Intergenic
975299767 4:72775598-72775620 AGGTTGACCTGCCTGCAGAAAGG + Intergenic
975498347 4:75058126-75058148 GGGACAACCTGCCTGCGGAAAGG + Intergenic
975498356 4:75058183-75058205 GGGACGACCTGCCTGTGGAAAGG + Intergenic
975913705 4:79298087-79298109 GGGACTACCTGCCTGAAGAGAGG + Intronic
976097796 4:81527913-81527935 GGGACAACCTGCCTGCAGAGAGG - Intronic
976511079 4:85910556-85910578 GGGACGACCTGTCTACAGAGAGG - Intronic
976511093 4:85910680-85910702 GGGTTGACCTGCCTGCAGAGAGG - Intronic
976921435 4:90449158-90449180 GGGATGACCTGCCTGCAGAGAGG - Intronic
977033953 4:91925211-91925233 AGAACGACCTGCCTACACAGTGG + Intergenic
977359138 4:95981434-95981456 GGGACACCCTGGCTGCAGAAAGG + Intergenic
977410320 4:96653785-96653807 GGGATGACCTGCCTGTGGAAAGG + Intergenic
977471903 4:97452777-97452799 GGGATGACCTGCCTGCAGAGAGG + Intronic
977645882 4:99410814-99410836 GGGACACCCTGGCTGCAGAAAGG - Intergenic
977816205 4:101416633-101416655 GGGATGACTTGCCTGCAGAGAGG - Intronic
978229882 4:106385717-106385739 GGGATGACCTGCCTGCAAAGAGG - Intergenic
978466770 4:109016691-109016713 AGGATGACCTGCCTGCAGAAAGG + Intronic
978466778 4:109016760-109016782 AGGATGACCTGCCTGCAGAAAGG + Intronic
978964496 4:114725161-114725183 TGAATGACCTGCCTACAGAAGGG - Intergenic
979090533 4:116477725-116477747 GGGACAACCTGCCTGCATAAAGG - Intergenic
979136730 4:117119162-117119184 GAGACTACCTGCCTGCAGATAGG - Intergenic
979637860 4:122977957-122977979 AGGATGACCTACCTGCAGAAAGG - Intronic
979637901 4:122978228-122978250 GGGGCAACCTGCCTGCAGAAAGG - Intronic
979649447 4:123113866-123113888 GAGATGACCTGCCTACAGAAAGG - Intronic
979649457 4:123113936-123113958 GGGACAACCTGCCTGCAGAGAGG - Intronic
980007632 4:127559639-127559661 GGGACAACCTGCCTGCAGAGAGG + Intergenic
980180274 4:129392984-129393006 GAGAGGACCTGCCTGCAGAGAGG + Intergenic
980574343 4:134666134-134666156 GGGATGATCTGCCTGCAGAGAGG - Intergenic
980574350 4:134666204-134666226 GGGACAACCTGCCTGCAGAGAGG - Intergenic
980703163 4:136457969-136457991 GGAATGATGTGCCTGCAGAAAGG + Intergenic
980730913 4:136823675-136823697 AGAACGTCCTGCCTGCGGAGAGG - Intergenic
980730923 4:136823746-136823768 GGGACAACCTGCCTGAAGAGAGG - Intergenic
981540349 4:145839943-145839965 GGAACGATATGCTTCCAGAATGG - Intronic
982157999 4:152540194-152540216 GGGACACCCTGGCTGCAGAAAGG - Intergenic
982181385 4:152751446-152751468 GAGACAACCTGCCTGCAGATAGG + Intronic
982802572 4:159722871-159722893 AGGATGATCTGCCTGCAGAAAGG - Intergenic
982959837 4:161822882-161822904 AGGACAACCTGCCTGCAGAAAGG - Intronic
983069677 4:163253921-163253943 GGGACAACCTGCCTGCAGATAGG - Intergenic
983380071 4:166981101-166981123 GGAACGACCTGCCTGCAGAAAGG - Intronic
983380125 4:166981441-166981463 GGGATGACATGCCTGCAGAAAGG - Intronic
983491950 4:168398936-168398958 GGGATTACCTGCCTGCAGAGAGG + Intronic
983651507 4:170040823-170040845 GGGACAACCTTCCTGCAGAAAGG + Intergenic
983807842 4:172017632-172017654 GAAACGACCCACCAGCAGAAAGG + Intronic
983885373 4:172975246-172975268 GGGATGACCTGCCTGCAGATAGG - Intronic
984296682 4:177862292-177862314 TGGGCGACCTGCCTGCAGAAAGG + Intronic
984296696 4:177862362-177862384 GGAATGACACACCTGCAGAAAGG + Intronic
984375366 4:178922498-178922520 AGAACGACCTGCCTGCAGAAAGG + Intergenic
984763809 4:183384378-183384400 TGGATGACCTGCCTACAGAAAGG + Intergenic
984763821 4:183384448-183384470 GGAATGACCTGCCTGTGTAAAGG + Intergenic
984763832 4:183384518-183384540 GGGACAACCTGCCTGCATAAAGG + Intergenic
1202759792 4_GL000008v2_random:99437-99459 GGGATGACCTGCCTGCAGAAAGG - Intergenic
985916168 5:2920518-2920540 GGGACGACCTGACTGCAGATAGG + Intergenic
986215039 5:5712337-5712359 GGGATGACCTGCCTACAGACAGG - Intergenic
987441976 5:17967532-17967554 GGAACTACCTGCCTGTGGATAGG - Intergenic
988325523 5:29761686-29761708 GGAAGGACCTGAGTGCAGCAGGG - Intergenic
988940422 5:36139714-36139736 GGGATAACCTGCCTGCAGATAGG + Intronic
988940433 5:36139782-36139804 AGGACAACCTGCCTGCAGAAAGG + Intronic
989425403 5:41290630-41290652 AGGATGACCTGCCTGCAGAAAGG - Intergenic
989520703 5:42396844-42396866 GAGAAGACCTGCCTGCAGAGAGG + Intergenic
989520711 5:42396915-42396937 GGGACACCCTGCCTGCAGAGAGG + Intergenic
989730436 5:44641679-44641701 GGAACAGCCTGCCTGTGGAAAGG - Intergenic
989821732 5:45800904-45800926 AGGACCACCTGTCTGCAGAAAGG + Intergenic
990023773 5:51160244-51160266 AGAATGACCTGCCTGCAGAGAGG + Intergenic
990878787 5:60517540-60517562 GGAACAACTGGCCTGCAGAGAGG + Intronic
990878795 5:60517610-60517632 GGGATGACCTGCCTGCAGAGAGG + Intronic
990878805 5:60517680-60517702 AGGACAACCTGCCTGCAGAGAGG + Intronic
991107577 5:62861748-62861770 AGAATGACCTGCCTACAGAGAGG - Intergenic
991524678 5:67543193-67543215 TGAATGAACTGCCTTCAGAAAGG + Intergenic
992029635 5:72708784-72708806 TGGACAACCTGTCTGCAGAAAGG - Intergenic
992029645 5:72708842-72708864 GGGATTACCTGCCTGCTGAAAGG - Intergenic
993187034 5:84634980-84635002 AGGATGACCTGCCTGCAGAGAGG - Intergenic
993211821 5:84961860-84961882 TGAGCAACCTGCCTGCAGAAAGG - Intergenic
994245347 5:97470853-97470875 GGGACACCCTGACTGCAGAAAGG - Intergenic
994245357 5:97470924-97470946 AAAACCACCTGCCTGCAGAGAGG - Intergenic
994246910 5:97488871-97488893 CAGACGAACTGCCTGCAGAAAGG - Intergenic
994406516 5:99352358-99352380 TAGATGACCTGCCTGCAGAAAGG - Intergenic
994406533 5:99352498-99352520 GGAATGACCTGCTTGCAGATGGG - Intergenic
994449906 5:99929182-99929204 GGAATGCTCTGCCTGCAGAGAGG - Intergenic
994451601 5:99950839-99950861 GGAATCACCTGCCTGTGGAAAGG + Intergenic
994593919 5:101807089-101807111 GCGACAACCTGCCTGCAGAGAGG + Intergenic
994692326 5:103034337-103034359 GGGATGAACTGCCTGCAGAAAGG - Intergenic
994692348 5:103034476-103034498 GGGAGGACATGCCTGCAGAGAGG - Intergenic
994790771 5:104223624-104223646 TGGACGACCTGCCTACAGAGAGG - Intergenic
994891345 5:105639993-105640015 GGGATGCCCTGCCTGCAGAGAGG + Intergenic
994891354 5:105640063-105640085 AGAATGATCTGCCTGCAGAGAGG + Intergenic
995146054 5:108787738-108787760 GGGACAACCTGCCTGTGGAAAGG + Intronic
995146067 5:108787806-108787828 GGGACAACCTGCCTGCAGAAAGG + Intronic
995332103 5:110957072-110957094 GGGACGATCTGCCTGCAGAAAGG + Intergenic
995386654 5:111596321-111596343 GGGACAACCTGCTTGCAGAAAGG + Intergenic
995386665 5:111596389-111596411 AGGATGACCTGCCTGCAGTAAGG + Intergenic
995724038 5:115166403-115166425 AAAATGACCTGCCTGCAGAGAGG + Intronic
995927037 5:117386599-117386621 TGGATGACCTGCCTGCAGATAGG + Intergenic
995927044 5:117386655-117386677 AGGATGACTTGCCTGCAGAAAGG + Intergenic
996923795 5:128799755-128799777 GGTATGACCTGCCTACAGAGAGG - Intronic
997042760 5:130277635-130277657 GGGACGACCTGCCTGTGGAAAGG - Intergenic
997266371 5:132497274-132497296 GGATGGACCTGCCTGCAGGGTGG + Intergenic
997960476 5:138316751-138316773 GGGAGGACCTGCCTGCAGAGAGG + Intronic
998792316 5:145778314-145778336 TGGACGACCTGCCTGCAGAGAGG + Intronic
998999701 5:147907071-147907093 GTAACAAACTGCCTGGAGAAGGG - Intergenic
999315345 5:150579896-150579918 GGGACAGCCTGCCTGCAGGAAGG + Intergenic
999799372 5:155019293-155019315 GAGACGACCTGCCGGCAGAGAGG - Intergenic
1000266303 5:159641275-159641297 AGGATGACCTGCCTGCAGAAAGG + Intergenic
1000426261 5:161094116-161094138 GGGATGACCTGCCTACAGAGAGG + Intergenic
1000854206 5:166379194-166379216 GGAACAACCTGCCTGTGGATAGG - Intergenic
1002072376 5:176687930-176687952 GGGACACCCTGGCTGCAGAAAGG - Intergenic
1002677993 5:180935011-180935033 GGGATGACCTGCCTGCAGAAAGG - Intronic
1002772583 6:302419-302441 AGAACGGTCAGCCTGCAGAAAGG - Intronic
1003439016 6:6122342-6122364 GGGACGACCTGCCTGTGCAAAGG + Intergenic
1003439034 6:6122468-6122490 AGGATGACCTGCCTACAGAAAGG + Intergenic
1004029342 6:11851014-11851036 GGAATGAACGGCCTGCAGAAGGG + Intergenic
1004520890 6:16359565-16359587 AGAATGACTTGCCTGCAGAGAGG + Intronic
1004720775 6:18265853-18265875 GGGACAACCCCCCTGCAGAAAGG - Intergenic
1004720790 6:18265923-18265945 AGGACCACCTGCCTGCAGAAAGG - Intergenic
1006463771 6:34178930-34178952 TGGATGACCTGCCTGCAGATAGG - Intergenic
1006467061 6:34202208-34202230 GGGATGACCTGCCTACAGAGAGG - Intergenic
1007649985 6:43413265-43413287 GGGATGACCTGCCTGCAGAGAGG + Intergenic
1007650007 6:43413406-43413428 GGAACACCTTGGCTGCAGAAAGG + Intergenic
1007999500 6:46344058-46344080 AGAAAGAACTGCCTGCAAAAGGG + Intronic
1008330621 6:50240580-50240602 GGGAAGACTTGCCTGCAGAGAGG - Intergenic
1008388931 6:50926442-50926464 GGAATGACCTGACTGCAAAAAGG - Intergenic
1008603110 6:53115018-53115040 GGAAAGAGCAGACTGCAGAAAGG + Intergenic
1009534280 6:64860866-64860888 GGGACGACCTGCCTGCTAAGAGG - Intronic
1009588661 6:65638207-65638229 AGGATGACCTGTCTGCAGAAAGG + Intronic
1009610127 6:65930831-65930853 GGGACAACCTGCCTGCAGAGAGG - Intergenic
1009870876 6:69451194-69451216 GGGATGACCTGCCTGTGGAAAGG - Intergenic
1010341161 6:74754855-74754877 GGGACAACCTGCCTGCAGAGAGG + Intergenic
1011284135 6:85705932-85705954 AGGACAACCTGCCTGCGGAAAGG - Intergenic
1011284157 6:85706072-85706094 GGGACAACCTACCTGAAGAAAGG - Intergenic
1011530106 6:88312291-88312313 AGGACAACCTGCCTGCAGAGAGG - Intergenic
1011822601 6:91271296-91271318 GGGATGACCTGCCTGCAGAAAGG - Intergenic
1012052230 6:94361042-94361064 GGGATTACCTGCCTGCAGAGAGG - Intergenic
1012205074 6:96451419-96451441 TGAAGAACCTGCCTGAAGAAAGG - Intergenic
1012231134 6:96762392-96762414 AGGACGACCTGCCTGCAAAGAGG - Intergenic
1012749507 6:103140134-103140156 AGGACAACCTGCCTGCAGATAGG - Intergenic
1013236016 6:108198525-108198547 CAAATGACCTGCCTGCAGAGAGG - Intergenic
1013451800 6:110288887-110288909 GGAACTCCTTGGCTGCAGAAAGG + Intronic
1013693113 6:112668280-112668302 GGGATGACCTGCCTGCAGAGAGG + Intergenic
1014227131 6:118861638-118861660 AGGTCAACCTGCCTGCAGAAAGG - Intronic
1014289326 6:119540048-119540070 GGGATCACCTGCCTGCAGAGAGG + Intergenic
1014289340 6:119540119-119540141 AGGATGACCTGCCTGCAGAGAGG + Intergenic
1014391699 6:120872610-120872632 AGAATGACCTGCCTGCAGACAGG + Intergenic
1014391721 6:120872750-120872772 GGGATGACCCGCCTGCAGAAAGG + Intergenic
1014968956 6:127791330-127791352 GGGACAATCAGCCTGCAGAAAGG - Intronic
1014968968 6:127791400-127791422 GGGATGGCCTGCCTACAGAAAGG - Intronic
1015096179 6:129417298-129417320 GGAATTACCTGCCTGTGGAACGG - Intronic
1015663740 6:135603888-135603910 GAGATGACCTGCCTGCAGAGAGG + Intergenic
1015663755 6:135603981-135604003 GGGACTACCTGCCTGCAGAGAGG + Intergenic
1016076716 6:139804849-139804871 GGGATGACCTGCCTGTGGAAAGG - Intergenic
1016076724 6:139804915-139804937 GGGATGATCTGCCTGCAGATAGG - Intergenic
1016163281 6:140908016-140908038 GGAATGACCTGCCTGCAGAACGG - Intergenic
1016163294 6:140908086-140908108 GGGATGACCTGCCTGGAGAAAGG - Intergenic
1016210864 6:141531780-141531802 GGGACGACTTGCCTGTGGAAAGG + Intergenic
1016237899 6:141890441-141890463 GGGACACCCTGCCTGCAGAGAGG + Intergenic
1016720060 6:147286188-147286210 GGAAAGAACTGCCAGAAGAAAGG - Intronic
1017054525 6:150425140-150425162 GGGACGACCTGCATGTAGACAGG + Intergenic
1017054534 6:150425209-150425231 GGGATGACCTGCCTGCAGAGAGG + Intergenic
1017587972 6:155947560-155947582 AGGATGACCTGCCTGCAGCAAGG + Intergenic
1020474805 7:8582478-8582500 GGGACAACCTGCTTGAAGAAAGG - Intronic
1020812410 7:12863791-12863813 AGGACGACCTGCCTACAGAGAGG - Intergenic
1020832528 7:13109954-13109976 GGGACAACCTACCTGCAGAGAGG - Intergenic
1021269978 7:18574118-18574140 AGGATGACCTGCTTGCAGAAAGG - Intronic
1021269988 7:18574188-18574210 GGGATGACCTGCCTGGAGAAAGG - Intronic
1021343100 7:19488876-19488898 GGAATGACCTGCCTGCAGATAGG - Intergenic
1021677711 7:23097711-23097733 AGGATGACCTACCTGCAGAAAGG + Intergenic
1022042034 7:26590616-26590638 GGGATGACCTGGCTGCAGAGTGG + Intergenic
1022391928 7:29950806-29950828 AGGATGACCTGCCTGCAGAATGG + Intronic
1022423386 7:30245638-30245660 GGGATGACCTGCTTGCAGAGAGG - Intergenic
1022600285 7:31751607-31751629 GACACTACCAGCCTGCAGAAGGG + Exonic
1023327090 7:39072048-39072070 GGAACCAGCTGCATGGAGAAAGG + Intronic
1023699452 7:42878072-42878094 GGGATCACCTGCCTGCAGAGAGG + Intergenic
1023889343 7:44381442-44381464 GGAACCACTGGCCTGCAGATGGG + Exonic
1024024667 7:45400284-45400306 GGGATGACCTGCCTGCGGAAAGG + Intergenic
1024254842 7:47532570-47532592 GGGATGACCTGCCTACAGAGAGG + Intronic
1024794843 7:53008281-53008303 AGACCGACCTGCCTGCAAATAGG + Intergenic
1024857006 7:53794252-53794274 GGGACCACCTGCCTGTGGAAAGG - Intergenic
1024857015 7:53794322-53794344 GAGATGACCTGCCTGCAGATAGG - Intergenic
1026391995 7:69911611-69911633 GGGATGACCTGCCTGTGGAAAGG - Intronic
1026393560 7:69928130-69928152 GGGACTACCTGCCTGCAGATAGG - Intronic
1027687360 7:81294674-81294696 GGGACGACCTGCCTGTGGAAAGG - Intergenic
1027779808 7:82507410-82507432 GGAACGACCTGCCTACAGAGAGG - Intergenic
1027924873 7:84447600-84447622 GGAATGACCTGCCTGTGGAAAGG + Intronic
1027995820 7:85424112-85424134 CGAACGACCTGCCTGCAGATAGG + Intergenic
1028024626 7:85821597-85821619 AGGATGACCTGCCTGCAGAGAGG + Intergenic
1028136795 7:87230825-87230847 AGGACAACCTGCCAGCAGAAAGG + Intergenic
1028136804 7:87230895-87230917 CAGACAACCTGCCTGCAGAAAGG + Intergenic
1028233359 7:88330822-88330844 GAGGCGACCTGCCTGCAGAGAGG + Intergenic
1029899346 7:104022689-104022711 GGGGTGACCTGCCTGCAGAGAGG + Intergenic
1030243908 7:107360255-107360277 GGGACGATCTGCTTGCAGAAAGG + Intronic
1030359485 7:108580019-108580041 GGGACTACCTGCCTGTGGAAAGG + Intergenic
1030484461 7:110148805-110148827 GGGATGACCTGCCTGCAGGGAGG - Intergenic
1030484470 7:110148869-110148891 GGTATGTCCTGCCTGCAGAGAGG - Intergenic
1030731107 7:112990443-112990465 AGATTGACCTGGCTGCAGAATGG - Intergenic
1030756377 7:113291903-113291925 GGAACGACCTGTCTGCAGAAAGG + Intergenic
1031786625 7:126041208-126041230 GGGACAGCCTGCCTGCAGAGAGG + Intergenic
1031859138 7:126958089-126958111 GAGGTGACCTGCCTGCAGAAAGG + Intronic
1031921926 7:127608724-127608746 GAAATGACCTGCCGGCAGAAAGG - Intergenic
1032591145 7:133193603-133193625 GGGACAACCTGCCTGTGGAAAGG - Intergenic
1032658307 7:133955423-133955445 AGGATGACCTGCCTGCAGAGAGG - Intronic
1034210371 7:149357958-149357980 GGGACAACCTGCCTGCAGAGAGG - Intergenic
1034406379 7:150905556-150905578 CGAATGACTTGCCTGCAGACAGG - Intergenic
1034481292 7:151321858-151321880 GGGACAACCTGTCTGCAGAGAGG + Intergenic
1035252353 7:157605656-157605678 GGGACCCCCTGGCTGCAGAAAGG - Intronic
1035328420 7:158080448-158080470 GGAGCACCCTGCCTGCGGAATGG + Intronic
1036907679 8:12720742-12720764 AGGAAGACCTGCCTGCAGAAAGG + Intergenic
1038149362 8:24928475-24928497 AGGACCACCTGCCTGCAGAGAGG + Intergenic
1039210110 8:35204311-35204333 GGGACGACCTGCCTGTGGAAAGG - Intergenic
1039211090 8:35215365-35215387 GAGACGACCTGCCTGAAGAGAGG - Intergenic
1040725606 8:50378723-50378745 GGGACAACCTGTCTGCAGAGAGG - Intronic
1041274456 8:56142786-56142808 GGGATGACTTGCCTGCAGATAGG + Intergenic
1042625129 8:70748935-70748957 AGGATGACCTGCCTGCATAAAGG + Intronic
1042687826 8:71461867-71461889 GGGATGACCTGTCTGCAGAGAGG - Intronic
1042864033 8:73341121-73341143 GGAACTCCTTGCCTGCAGAGAGG - Intergenic
1043087130 8:75849207-75849229 GGGATAACCTGCCTGCAGAGAGG - Intergenic
1043180542 8:77082633-77082655 TGGATGACCTGCTTGCAGAAAGG - Intergenic
1043180552 8:77082703-77082725 GGGACAACCTGCCTGTGGAAAGG - Intergenic
1043414535 8:80033758-80033780 AGGACAACCTGCCTGCAGAAAGG - Intronic
1043568068 8:81570537-81570559 AGGACGACCTGCCTGCTGAGAGG - Intergenic
1043568086 8:81570659-81570681 GGGACAAGCTGCCTGCAGAAAGG - Intergenic
1043708013 8:83377985-83378007 GGGGTAACCTGCCTGCAGAATGG - Intergenic
1044409574 8:91868361-91868383 GAGACGACCTGCCTGCAGAGAGG + Intergenic
1044524933 8:93241387-93241409 AGGATGACCTGCCTGCAGAGAGG - Intergenic
1044962385 8:97543208-97543230 GGGATGACCTGCCTACAGAGAGG + Intergenic
1045300688 8:100907930-100907952 AGGACCACGTGCCTGCAGAAAGG - Intergenic
1045873399 8:106950562-106950584 GGGATGACCTGCCTGTGGAAAGG + Intergenic
1045873410 8:106950632-106950654 GGGATGACCTGCCTGCATAAAGG + Intergenic
1046186999 8:110734561-110734583 CGAATGACCTGCCTGCTGAAAGG - Intergenic
1046195737 8:110860675-110860697 GGGATGACCTGCCTGCAGAAAGG + Intergenic
1046249638 8:111612567-111612589 AGAACTACCTGCCTGCAGGTAGG - Intergenic
1046407294 8:113790917-113790939 GGGACAACCTTCCTGCAGAAAGG - Intergenic
1046503717 8:115111320-115111342 GGGATGACCTGCCTGCAGAGAGG - Intergenic
1046775415 8:118158863-118158885 GAGACAACCTGCCTGCAGAAAGG + Intergenic
1047318322 8:123754811-123754833 AGGACAACTTGCCTGCAGAAAGG - Intergenic
1047318332 8:123754881-123754903 GGGACAACCTGCCTGCAGAAAGG - Intergenic
1048339084 8:133525255-133525277 GGGATGACCTAACTGCAGAAAGG - Intronic
1048693010 8:136989243-136989265 GCGATGACCTGCCTGCAGAAAGG - Intergenic
1048693024 8:136989313-136989335 AGGACAGCCTGCCTGCAGAAAGG - Intergenic
1049295063 8:141828565-141828587 GGCATGACCTCCCTCCAGAAGGG + Intergenic
1049824065 8:144655612-144655634 AGGACGACCTGCCTACAGAGAGG + Intergenic
1050808921 9:9719181-9719203 AGGATGACCTGCCTGCAGATAGG + Intronic
1051001785 9:12290915-12290937 GGGACAACCTGCCTACAGAGAGG + Intergenic
1051355239 9:16234517-16234539 GGGACAACCTGCCTGCAGAAAGG + Intronic
1052466785 9:28839586-28839608 GGGACCACCAGCCTGCAGAAAGG - Intergenic
1052552507 9:29969495-29969517 GGGATGCCTTGCCTGCAGAAAGG - Intergenic
1052597153 9:30575145-30575167 GGGACGACCTGCCTGCAGAAAGG + Intergenic
1052609821 9:30758443-30758465 CGGACGACCTGCCTGTGGAAAGG - Intergenic
1052609832 9:30758513-30758535 GGGACAACCTGCCTGCGGAAAGG - Intergenic
1052609846 9:30758583-30758605 GGGACAACCTGCCCGCACAAAGG - Intergenic
1052623556 9:30944589-30944611 GGGATGAACTGCCTGCAGAAAGG + Intergenic
1052691468 9:31821145-31821167 GGGATGACCTGCCTGCAGATAGG + Intergenic
1052691482 9:31821216-31821238 AGGATGACCTGCCTGCAGATAGG + Intergenic
1053617432 9:39782067-39782089 CGGACGACCTGCCTGCAGAGAGG + Intergenic
1053619142 9:39798498-39798520 GGGATGACCTGCCTGCAGAGAGG - Intergenic
1053875614 9:42541430-42541452 CGGACGACCTGCCTGCAGAGAGG + Intergenic
1053897032 9:42753203-42753225 CGGACGACCTGCCTGCAGAGAGG - Intergenic
1054236085 9:62560294-62560316 CGGACGACCTGCCTGCAGAGAGG - Intergenic
1054265015 9:62908931-62908953 GGGATGACCTGCCTGCAGAGAGG + Intergenic
1054266734 9:62925370-62925392 CGGACGACCTGCCTGCAGAGAGG - Intergenic
1054550227 9:66594824-66594846 CGGACGACCTGCCTGCAGAGAGG - Intergenic
1055645486 9:78357896-78357918 GGGATGACCTGCCTGCAGAGAGG + Intergenic
1055752775 9:79526034-79526056 GGAAAGCCCTGGCTTCAGAACGG + Intergenic
1055890870 9:81122437-81122459 GGGATGCCCTGCCTGCAGAGGGG - Intergenic
1056191988 9:84194114-84194136 GGGATGACCTGCCTACAGAAAGG - Intergenic
1056462194 9:86818734-86818756 AGAACGACCTGCCTGCGGAAAGG + Intergenic
1056994406 9:91443065-91443087 TGCATGACCTGCCTGCAGAAAGG - Intergenic
1058280173 9:103103853-103103875 GGGACAACCTGCCTGTGGAAAGG + Intergenic
1058510837 9:105714172-105714194 GGGAGGACCTGCTTGCAGAGAGG + Intronic
1058545740 9:106059185-106059207 GGAATGACCTGCCTACAAATAGG - Intergenic
1059401253 9:114071771-114071793 GGGATGACTTGCCTGCAGAGAGG + Intronic
1059401260 9:114071841-114071863 CAGATGACCTGCCTGCAGAAAGG + Intronic
1059401271 9:114071912-114071934 AGAACACCCTGGCTGCAGAAAGG + Intronic
1059681569 9:116590906-116590928 AGGATGACCTGCCTTCAGAAAGG + Intronic
1060618820 9:125044365-125044387 GGGATGACATGCCTACAGAAAGG + Intronic
1060618837 9:125044496-125044518 TGGACAACCTGCTTGCAGAAAGG + Intronic
1061283081 9:129608589-129608611 TGAATGAGCCGCCTGCAGAATGG + Intergenic
1061743202 9:132722315-132722337 GGGACGACCTGCCTGCAGAAAGG - Intergenic
1062049776 9:134441243-134441265 GGAACGGCCTGCCACCTGAAAGG + Intergenic
1203691582 Un_GL000214v1:47652-47674 GGGATGACTTGCCTGCAGAAAGG - Intergenic
1203751809 Un_GL000218v1:87153-87175 GGGATGACCTGCCTGCAGAAAGG + Intergenic
1203710484 Un_KI270742v1:93122-93144 GGGATGACCTGCCTGCTGAAAGG + Intergenic
1203540568 Un_KI270743v1:84332-84354 GGGATGACCTGCCTGCAGAAAGG - Intergenic
1203644713 Un_KI270751v1:56539-56561 GGGATGACTTGCCTGCAGAAAGG + Intergenic
1186805882 X:13139681-13139703 GGGATGAACTGCCTGCAGAAAGG + Intergenic
1187871182 X:23766619-23766641 GGGACAACCTGCCTGCGGAAAGG - Intergenic
1188434914 X:30148740-30148762 GGGATGACCTGCCTGCAGATAGG + Intergenic
1188434926 X:30148811-30148833 GGGACGACCTGCCTGCAGACGGG + Intergenic
1188647901 X:32592423-32592445 AGGATGACCTGCCTGCATAAAGG + Intronic
1188647916 X:32592493-32592515 GGGACGACCTGCCTGTGGAAAGG + Intronic
1188990955 X:36819798-36819820 GGAAAGACCTGCCTTCAATAAGG + Intergenic
1189360230 X:40344239-40344261 CAAACGACCTGCCTGCAGAGAGG + Intergenic
1190444826 X:50514346-50514368 CGAACGACTTGCCTGCAGAGAGG - Intergenic
1190620647 X:52284297-52284319 AGGACGACCTGTCTGCAGAGAGG - Intergenic
1190621129 X:52287963-52287985 AGGACTACCTGCCTGCGGAAAGG + Intergenic
1190621158 X:52288170-52288192 GGGATGACCTGCCTGTAGAAAGG + Intergenic
1190621172 X:52288246-52288268 GGGACAACCTGCCTGCGGATAGG + Intergenic
1190621197 X:52288384-52288406 GGGATGACCTGCCTGTAGAAAGG + Intergenic
1190621231 X:52288594-52288616 AGGATGACCTGCTTGCAGAAAGG + Intergenic
1190681781 X:52831906-52831928 GGAAAGACCTGCCTGCAAAGAGG + Intergenic
1190998869 X:55637905-55637927 GGAAAGACCTGCCTGCAGAGAGG + Intergenic
1191016402 X:55814037-55814059 GGGACAACCAGCCTGCAGAAAGG + Intergenic
1191221293 X:57990501-57990523 GGGATGACCTGCCTACAGAGAGG + Intergenic
1192267244 X:69547207-69547229 AGGACGACCTGCCTGCGGAGAGG + Intergenic
1193211419 X:78811023-78811045 AGGATGACCTGCCTGCAGAAAGG - Intergenic
1193467626 X:81868084-81868106 GGGACAACCTGCCTGCAGAGAGG - Intergenic
1193468700 X:81875100-81875122 GGGATTACCTGCCTGCAGAGAGG - Intergenic
1194212235 X:91082811-91082833 GGGATGATCTGCCTGCAGAAAGG + Intergenic
1194212243 X:91082881-91082903 GGAATGACCTGCCTGCAGAAAGG + Intergenic
1194413103 X:93579163-93579185 GGAATGACCTGCCTGCAGAAAGG + Intergenic
1194891461 X:99384509-99384531 GAGACAACCTGCCTGCAGAAAGG - Intergenic
1195178514 X:102334008-102334030 GGGATGACCTGCCTGCAGAGAGG - Intergenic
1195179020 X:102339069-102339091 GGAACATCCTGCCTGTGGAAAGG - Intergenic
1195180350 X:102353075-102353097 GGGATGACCTGCCTGCAGAGAGG + Intergenic
1195655066 X:107325141-107325163 GGGACGACCTGCTTGCAGAGAGG + Intergenic
1197035448 X:121869011-121869033 GGGATGACCTGCCTGTGGAAAGG + Intergenic
1197421320 X:126238800-126238822 GGGACGACCTGCCTACAGAGAGG + Intergenic
1197795952 X:130299161-130299183 TGAATGACCTGCCAGCAGAGAGG - Intergenic
1198699416 X:139381808-139381830 AGGACGACCTGCCTGCAGTGAGG - Intergenic
1199614838 X:149648113-149648135 GGGACACCCTGCCTGCAGGAAGG + Intergenic
1200424831 Y:3009249-3009271 GGGACAACCAGCCTGCAGAAAGG - Intergenic
1200424841 Y:3009319-3009341 AGGACAACCTGCTTGCAGAAAGG - Intergenic
1200972186 Y:9164457-9164479 AGCACGAACTGCCTGCAGATTGG + Intergenic
1201165463 Y:11204773-11204795 GGGATGACCTGCCTGCAGAAAGG + Intergenic